Skip to Content
Merck
All Photos(1)

Key Documents

EHU029261

Sigma-Aldrich

MISSION® esiRNA

targeting human FANCD2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCGACTTGACCCAAACTTCCTATTGAAGGTTCGCCAGTTGGTGATGGATAAGTTGTCGTCTATTAGATTGGAGGATTTACCTGTGATAATAAAGTTCATTCTTCATTCCGTAACAGCCATGGATACACTTGAGGTAATTTCTGAGCTTCGGGAGAAGTTGGATCTGCAGCATTGTGTTTTGCCATCACGGTTACAGGCTTCCCAAGTAAAGTTGAAAAGTAAAGGACGAGCAAGTTCCTCAGGAAATCAAGAAAGCAGCGGTCAGAGCTGTATTATTCTCCTCTTTGATGTAATAAAGTCAGCTATTAGATATGAGAAAACCATTTCAGAAGCCTGGATTAAGGCAATTGAAAACACTGCCTCAGTATCTGAACACAAGGTGTTTGACCTGGTGATGCTTTTCATCATCTATAGCACCAATACTCAGACAAAGAAGTACATTGACAGGGTGCTAAGAAATAAGATTCGATCAGGCTGCATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jian Chen et al.
Hepatology (Baltimore, Md.), 65(2), 678-693 (2017-01-24)
Exposure to genotoxins such as ethanol-derived acetaldehyde leads to DNA damage and liver injury and promotes the development of cancer. We report here a major role for the transforming growth factor β/mothers against decapentaplegic homolog 3 adaptor β2-Spectrin (β2SP, gene
Anaid Benitez et al.
Molecular cell, 71(4), 621-628 (2018-07-31)
FANCA is a component of the Fanconi anemia (FA) core complex that activates DNA interstrand crosslink repair by monoubiquitination of FANCD2. Here, we report that purified FANCA protein catalyzes bidirectional single-strand annealing (SA) and strand exchange (SE) at a level
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service