MIRAP01217
MystiCq® microRNA qPCR Assay Primer
mmu-miR-1a-1-5p
Sign Into View Organizational & Contract Pricing
All Photos(1)
About This Item
form
liquid
concentration
10 mg/mL
mature sequence
ACAUACUUCUUUAUAUGCCCAUA
mp
~76 °C
Sanger mature/minor accession no.
shipped in
wet ice
storage temp.
−20°C
Gene Information
mouse ... MIR1A-1(387136)
General description
The MystiCq® microRNA qPCR Assay Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific microRNAs with the MystiCq Universal PCR primer and the MystiCq® microRNA SYBR® Green qPCR ReadyMix™ on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.
Features and Benefits
- Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs
- Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence
- No self-complementarity or primer dimer artifacts with the Universal PCR Primer
- Optimized primer Tm designed to match the Universal PCR Primer
- Universal cycling conditions ensures robust amplification for all assays in profiling experiments
- Optimized PCR product Tm (75-78° C)
Other Notes
Formerly mmu-miR-1a-1*.
Legal Information
MystiCq is a registered trademark of QIAGEN Beverly Inc.
ReadyMix is a trademark of Sigma-Aldrich Co. LLC
SYBR is a registered trademark of Life Technologies
Storage Class Code
12 - Non Combustible Liquids
WGK
WGK 1
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Certificates of Analysis (COA)
Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Katarzyna Goljanek-Whysall et al.
Development (Cambridge, England), 141(17), 3378-3387 (2014-08-01)
Myogenesis involves the stable commitment of progenitor cells followed by the execution of myogenic differentiation, processes that are coordinated by myogenic regulatory factors, microRNAs and BAF chromatin remodeling complexes. BAF60a, BAF60b and BAF60c are structural subunits of the BAF complex
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service