Skip to Content
Merck
All Photos(3)

Key Documents

M1882

Sigma-Aldrich

Myoglobin from equine heart

≥90% (SDS-PAGE), essentially salt-free, lyophilized powder

Synonym(s):

Myoglobin from horse heart

Sign Into View Organizational & Contract Pricing


About This Item

CAS Number:
EC Number:
MDL number:
UNSPSC Code:
12352202
NACRES:
NA.61

Pricing and availability is not currently available.

biological source

equine heart

Quality Level

Assay

≥90% (SDS-PAGE)

form

essentially salt-free, lyophilized powder

Iron content

≥0.20%

technique(s)

MALDI-MS: suitable

UniProt accession no.

storage temp.

−20°C

Gene Information

horse ... MB(100054434)

Looking for similar products? Visit Product Comparison Guide

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU124581EHU034541EHU001111
Gene Information

human ... NEK10(152110), NEK10(152110)

Gene Information

human ... NEK10(152110), NEK10(152110)

Gene Information

human ... PEBP4(157310), AC105046.10(157310)

Gene Information

human ... NIPAL1(152519), NPAL1(152519)

esiRNA cDNA target sequence

GGATAACTCCAGCAGCTCCAGTTCAAGCCCTCTGAAAGAATCTACATTCAACATTTTAAAGAGAAGTTTTAGTGCTTCAGGAGGAGAAAGACAATCCCAAACAAGGGACTTCACTGGAGGAACAGGATCAAGACCAAGACCAGCTTTGCTGCCTCTTGACCTGCTTCTGAAAGTGCCACCCCACATGCTCAGGGCCCACATTAAGGAAATAGAGGCTGAGTTAGTGACAGGGTGGCAGTCCCATAGCCTTCCTGCTGTGATTCTTCGAAATCTCAAAGATCATGGGCCACAGATGGGCACATTCTTGTGGCAAGCATCAGCAGGAATTGCT

esiRNA cDNA target sequence

GGATAACTCCAGCAGCTCCAGTTCAAGCCCTCTGAAAGAATCTACATTCAACATTTTAAAGAGAAGTTTTAGTGCTTCAGGAGGAGAAAGACAATCCCAAACAAGGGACTTCACTGGAGGAACAGGATCAAGACCAAGACCAGCTTTGCTGCCTCTTGACCTGCTTCTGAAAGTGCCACCCCACATGCTCAGGGCCCACATTAAGGAAATAGAGGCTGAGTTAGTGACAGGGTGGCAGTCCCATAGCCTTCCTGCTGTGATTCTTCGAAATCTCAAAGATCATGGTAGTACTTACTAGATCACATTGATGTTAAGCACACAATGGGCAAATGCAGAAT

esiRNA cDNA target sequence

CTCATGATGGTGGTCACTGGAGACGAGGATGAGAACAGCCCGTGTGCCCATGAGGCCCTCTTGGACGAGGACACCCTCTTTTGCCAGGGCCTTGAAGTTTTCTACCCAGAGTTGGGGAACATTGGCTGCAAGGTTGTTCCTGATTGTAACAACTACAGACAGAAGATCACCTCCTGGATGGAGCCGATAGTCAAGTTCCCGGGGGCCGTGGACGGCGCAACCTATATCCTGGTGATGGTGGATCCAGATGCCCCTAGCAGAGCAGAACCCAGACAGAGATTCTGGAGACATTGGCTGGTAACAGATATCAAGGGCGCCGACCTGAAGAAAGGGAAGATTCAGGGCCAGGAGTTATCAGCCTACCAGGCTCCCTCCCCACCGGCACACAGTGGCTTCCATCGCTACCAGTTC

esiRNA cDNA target sequence

GCCCCACAAGAAGAGGAAGTCACATCTTTGCATGAAATGGAAATGAAATTGAGAGACCCAGGGTTTATTTCCTTTGCTGTGATCATAACTGTGATCTCCTTGGTGCTGATTTTGATTGTGGCTCCCAAGAAAGGACAGACCAATATATTGGTTTATATTTCAATCTGTTCCTTGATTGGAGCGTTTTCAGTTTCTTCTGTGAAAGGCCTGGGAATTGCCATTAAGGAGCTGATAGAATGGAAGCCAGTTTACAAACATCCGCTGGTCTTTGTTTTGCTGGCTGTACTTGTGCTTTCAGTAACTACACAGATTAACTATCTCAACAAGGCACTGGACACCTTTAATACCTCTCTTGTGACACCCATTTATTATGTATTCTTCACATCCATGGTAGTGACTTGCTCTGCCATCTTATTCCAAGAGTGGTATGGCATGACAGCTG

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

Application

Myoglobin from equine heart is suitable for use in:
  • spectral measurements in Beckman DU-50 or Gilford 2400 spectrophotometer[1]
  • the secondary structure analysis of proteins in H2O solution using single-pass attenuated total reflection Fourier transform infrared (ATR-FT-IR) microscopy[2]
  • the calibration of the mass scale at a concentration of 2 pmol/μL in Electrospray mass spectrometry[3]
  • a study to investigate on-line single droplet deposition for MALDI mass spectrometry[4]
  • a study to examine protein adsorption in fused-silica and polyacrylamide-coated capillaries[5]

Biochem/physiol Actions

Myoglobin is a mobile carrier of oxygen that is developed in red muscle and heart cells. This happens as a response to elevated demand for oxygen during exercise, and transports oxygen from the sarcolemma to the mitochondria of vertebrate heart and red muscle cells.[6]

Storage Class Code

11 - Combustible Solids

WGK

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Personal Protective Equipment

dust mask type N95 (US), Eyeshields, Gloves

  • Choose from one of the most recent versions:

    Certificates of Analysis (COA)

    Lot/Batch Number

    Don't see the Right Version?

    If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

    Already Own This Product?

    Find documentation for the products that you have recently purchased in the Document Library.

    Visit the Document Library

    Ursula Waack et al.
    mBio, 9(6) (2018-12-20)
    Antibiotic-resistant Acinetobacter baumannii is increasingly recognized as a cause of difficult-to-treat nosocomial infections, including pneumonia, wound infections, and bacteremia. Previous studies have demonstrated that the metalloprotease CpaA contributes to virulence and prolongs clotting time when added to human plasma as
    D H Robertson et al.
    Rapid communications in mass spectrometry : RCM, 11(7), 786-790 (1997-01-01)
    Major urinary proteins (MUPs) from the urine of individual wild mice were characterized using electrospray ionization mass spectrometry (ESI-MS) and compared to MUPs from the urine of inbred mice. The wild mice showed considerable variation between individuals in the expression
    Guadalupe Gómez-Baena et al.
    Scientific reports, 9(1), 10757-10757 (2019-07-26)
    Major urinary proteins (MUP) are the major component of the urinary protein fraction in house mice (Mus spp.) and rats (Rattus spp.). The structure, polymorphism and functions of these lipocalins have been well described in the western European house mouse
    Cassandra M Stawicki et al.
    Scientific reports, 11(1), 19921-19921 (2021-10-09)
    Fluorescently labeled antibody and aptamer probes are used in biological studies to characterize binding interactions, measure concentrations of analytes, and sort cells. Fluorescent nanoparticle labels offer an excellent alternative to standard fluorescent labeling strategies due to their enhanced brightness, stability
    V Kery et al.
    The Journal of biological chemistry, 269(41), 25283-25288 (1994-10-14)
    The first committed step of transsulfuration is catalyzed by cystathionine beta-synthase (CBS), a known pyridoxal 5'-phosphate (PLP) enzyme. The inferred amino acid sequences of rat liver CBS and rat liver hemoprotein H-450 are identical. We now confirm the presence of

    Protocols

    Separation of HPLC protein standard mixture, analytical standard

    Chromatograms

    application for HPLC

    Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

    Contact Technical Service