Skip to Content
Merck
All Photos(1)

Key Documents

EMU074771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bcl2l11

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCGGAGACGAGTTCAACGAAACTTACACAAGGAGGGTGTTTGCAAATGATTACCGCGAGGCTGAAGACCACCCTCAAATGGTTATCTTACAACTGTTACGCTTTATCTTCCGTCTGGTATGGAGAAGGCATTGACAGGATCTACATGCAGCCAGGATACGTGGCGGACATGGCTCTTGTTCAGACTGGGAGAACCCCCACGCGTCATGTCCCTCTCTTGGTGCTGCGACAGTGTGTCCAGTGGTTCTATCCCAGAGAGATGTGCTGAGCATGGACAGCGCTCTGCACTGTGTCGATGTGAACGGAACCTCTGTTCATCACCACATGGCCGAGTTTTCAGTAAATATTTGTTGTGAATGTAAACAAGGGAGGGCTTTTCTCTTTTTAATGTACAGATCCTAGGAACAGAGAAATATGCAAGAGAGGTGTTTACATGTGGCGTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Oluwafunmilayo F Lamidi et al.
Journal of cancer research and clinical oncology, 141(9), 1575-1583 (2015-01-31)
Tubulysins are natural tetrapeptides that inhibit tubulin polymerisation. Tubulysins are very potent inhibitors of mammalian cancer cell growth, but restricted availability has limited their characterisation and development as anti-cancer compounds. KEMTUB10 was recently developed as a synthetic analogue of natural
Gong-Quan Li et al.
Oncotarget, 7(3), 2462-2474 (2015-11-18)
Bromodomain 4 (BRD4) is an epigenetic regulator that, when inhibited, has anti-cancer effects. In this study, we investigated whether BRD4 could be a target for treatment of human hepatocellular carcinoma (HCC). We show that BRD4 is over-expressed in HCC tissues.
S L Locatelli et al.
Leukemia, 28(9), 1861-1871 (2014-02-25)
Relapsed/refractory Hodgkin's lymphoma (HL) is an unmet medical need requiring new therapeutic options. Interactions between the histone deacetylase inhibitor Givinostat and the RAF/MEK/ERK inhibitor Sorafenib were examined in HDLM-2 and L-540 HL cell lines. Exposure to Givinostat/Sorafenib induced a synergistic
Anja Heinemann et al.
Oncotarget, 6(25), 21507-21521 (2015-06-19)
Histone acetylation marks have an important role in controlling gene expression and are removed by histone deacetylases (HDACs). These marks are read by bromodomain and extra-terminal (BET) proteins and novel inhibitiors of these proteins are currently in clinical development. Inhibitors
Lin Deng et al.
The Journal of general virology, 96(9), 2670-2683 (2015-08-25)
We previously reported that hepatitis C virus (HCV) infection induces Bax-triggered, mitochondrion-mediated apoptosis by using the HCV J6/JFH1 strain and Huh-7.5 cells. However, it was still unclear how HCV-induced Bax activation. In this study, we showed that the HCV-induced activation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service