Skip to Content
Merck
All Photos(1)

Key Documents

EHU093811

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR8

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAGCCATTCCTCATGTCAAATATTTGGATTTGACAAACAATAGACTAGACTTTGATAATGCTAGTGCTCTTACTGAATTGTCCGACTTGGAAGTTCTAGATCTCAGCTATAATTCACACTATTTCAGAATAGCAGGCGTAACACATCATCTAGAATTTATTCAAAATTTCACAAATCTAAAAGTTTTAAACTTGAGCCACAACAACATTTATACTTTAACAGATAAGTATAACCTGGAAAGCAAGTCCCTGGTAGAATTAGTTTTCAGTGGCAATCGCCTTGACATTTTGTGGAATGATGATGACAACAGGTATATCTCCATTTTCAAAGGTCTCAAGAATCTGACACGTCTGGATTTATCCCTTAATAGGCTGAAGCACATCCCAAATGAAGCATTCCTTAATTTGCCAGCGAGTCTCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

G Comito et al.
Oncogene, 38(19), 3681-3695 (2019-01-22)
Leukocyte infiltration plays an active role in controlling tumor development. In the early stages of carcinogenesis, T cells counteract tumor growth. However, in advanced stages, cancer cells and infiltrating stromal components interfere with the immune control and instruct immune cells
Huanle Luo et al.
Antiviral research, 151, 55-62 (2018-01-15)
Zika virus (ZIKV) is a mosquito-borne flavivirus associated with severe neonatal birth defects, but the causative mechanism is incompletely understood. ZIKV shares sequence homology and early clinical manifestations with yellow fever virus (YFV) and dengue virus (DENV) and are all
Mark A Bernard et al.
PloS one, 9(8), e104039-e104039 (2014-08-05)
Even though combined anti-retroviral therapy (cART) dramatically improves patient survival, they remain at a higher risk of being afflicted with non-infectious complications such as cardiovascular disease (CVD). This increased risk is linked to persistent inflammation and chronic immune activation. In
Noriko Ishii et al.
Journal of immunology (Baltimore, Md. : 1950), 193(10), 5118-5128 (2014-10-10)
Nucleic acid-sensing TLRs are involved in both antimicrobial immune responses and autoimmune inflammation. TLR8 is phylogenetically and structurally related to TLR7 and TLR9, which undergo proteolytic processing in the endolysosomes to generate functional receptors. Recent structural analyses of human TLR8
Ryoichiro Nishibayashi et al.
PloS one, 10(6), e0129806-e0129806 (2015-06-18)
Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service