Skip to Content
Merck
All Photos(1)

Key Documents

EHU075381

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM17

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTTGGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTATAATCAGAATCAACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTTGTTAATGATACCAAAGACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGAATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATTTAAAAGTGGATAATGAAGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGAAGAGCTTGTTCATCGAGTGAAAAGAAGAGCTGACCCAGATCCCATGAAGAACACGTGTAAATTATTGGTGGTAGCAGATCATCGCTTCTACAGATACATGGGCAGAGGGGAAGAGAGTACAACTACAAATTACTTAATAGAGCTAATTGACAGAGTTGATGACATCTATCGGAACACTTCATGGG

Ensembl | human accession no.

ENSG00000151694

NCBI accession no.

NM_003183

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ADAM17(6868) , ADAM17(6868)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Junsuke Uwada et al.
Cellular signalling, 35, 188-196 (2017-04-17)
Intestinal epithelial cells form a tight barrier to act as selective physical barriers, repelling hostile substances. Tumor necrosis factor-α (TNF-α) is a well characterized pro-inflammatory cytokine which can compromise intestinal barrier function and the suppression of TNF-α function is important
Takaaki Uchibori et al.
Cytokine, 90, 88-95 (2016-11-20)
Osteopontin (OPN) is a pro-fibrotic molecule upregulated by pro-inflammatory cytokines. Interleukin (IL)-6 functions downstream of IL-1β and has unique signal pathways: classic- or trans-signaling via membrane-bound IL-6R or soluble IL-6R (sIL-6R). We investigated the effect of IL-6 trans-signaling on the
Qi Zhang et al.
Biochemical and biophysical research communications, 503(4), 2333-2339 (2018-07-03)
We investigated the role of a disintegrin and metalloproteinase 17 (ADAM17) in chemo resistance, and to clarify the mechanism underlying reverse of L-OHP resistance by knockdown of ADAM17. CRC tissues with corresponding adjacent normal tissues were collected. The mRNA and
Franziska Rademacher et al.
Experimental dermatology, 26(3), 227-233 (2016-08-12)
The ribonuclease RNase 7 is a major skin-derived human antimicrobial protein expressed in keratinocytes. Here we show that the gram-negative pathogen Pseudomonas aeruginosa secretes factor(s) that induced RNase 7 gene and protein expression in human primary keratinocytes. The metalloprotease inhibitor
Timo Effenberger et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 28(11), 4847-4856 (2014-08-01)
Cellular senescence, a state of persistent cell cycle arrest, has emerged as a potent tumor suppressor mechanism by restricting proliferation of cells at risk for neoplastic transformation. Senescent cells secrete various growth factors, cytokines, and other proteins that can either
View All Related Papers

Protocols

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service