Skip to Content
Merck
All Photos(1)

Key Documents

EHU024601

Sigma-Aldrich

MISSION® esiRNA

targeting human MTDH

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCACAGTTACCACCGAGCAACTTACAACCGCATCATTTCCTGTTGGTTCCAAGAAGAATAAAGGTGATTCTCATCTAAATGTTCAAGTTAGCAACTTTAAATCTGGAAAAGGAGATTCTACACTTCAGGTTTCTTCAGGATTGAATGAAAACCTCACTGTCAATGGAGGAGGCTGGAATGAAAAGTCTGTAAAACTCTCCTCACAGATCAGTGCAGGTGAGGAGAAGTGGAACTCCGTTTCACCTGCTTCTGCAGGAAAGAGGAAAACTGAGCCATCTGCCTGGAGTCAAGACACTGGAGATGCTAATACAAATGGAAAAGACTGGGGAAGGAGTTGGAGTGACCGTTCAATATTTTCTGGCATTGGGTCTACTGCTGAGCCAGTTTCTCAGTCTACCACTTCTGATTATCAGTGGGATGTTAGCCGTAATCAACCCTATATCGATGATGAATGGTCTGGGTTAAATGGTCTGTCTTCTGCTGATCCCA

Ensembl | human accession no.

ENSG00000147649

NCBI accession no.

NM_178812

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MTDH(92140) , MTDH(92140)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rongquan He et al.
American journal of translational research, 9(4), 1561-1579 (2017-05-05)
Recent studies found that metadherin (MTDH) played an essential role in hepatocellular carcinoma (HCC). Nevertheless, the exact function of MTDH in the pathogenesis of HCC was unclarified. In the present study, we aimed to investigate the clinical significance of MTDH
Yongfeng Zhang et al.
Molecular medicine reports, 18(3), 3099-3105 (2018-07-18)
MicroRNAs (miRNAs/miRs) serve important roles in regulating gene expression by directly binding to the 3'‑untranslated regions of target genes. Multiple miRNAs are dysregulated in retinoblastoma (RB) and their dysregulation is closely related to RB malignancy. Therefore, exploring the detailed roles
Dong Pan et al.
International journal of oncology, 54(6), 1955-1968 (2019-05-14)
Studies have rarely been conducted on the role of miRNAs in prostate cancer (PCa) cell progression by directly targeting MTDH, at least to the best of our knowledge. Thus, the present study aimed to identify miRNAs closely related with metadherin
Fan Yang et al.
OncoTargets and therapy, 12, 4415-4426 (2019-06-27)
Purpose: Several microRNAs (miRNAs) that are aberrantly expressed in glioblastoma multiforme (GBM) play a significant role in GBM formation and progression. The expression profile and functions of miR-559 in GBM remain unclear. Here, we quantified the expression and investigated the
Kensuke Suzuki et al.
Oncotarget, 8(39), 66098-66111 (2017-10-17)
Pancreatic ductal adenocarcinoma (PDAC) has a high metastatic potential. However, the mechanism of metastatic colonization in PDAC remains poorly understood. Metadherin (MTDH) has emerged in recent years as a crucial mediator of metastasis in several cancer types, although the biological
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service