Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU016621

Sigma-Aldrich

MISSION® esiRNA

targeting human CEBPG

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATCCATACCCAGGCACATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCTGGGGGAGGAGGCAAAGCTGTGGCTCCCAGCAAGCAGAGCAAAAAGAGTTCGCCCATGGATCGAAACAGTGACGAGTATCGGCAACGCCGAGAGAGGAACAACATGGCTGTGAAAAAGAGCCGGTTGAAAAGCAAGCAGAAAGCACAAGACACACTGCAGAGAGTCAATCAGCTCAAAGAAGAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTAAGTGTACTCAAAGATTTGTTTCTTGAGCATGCACACAACCTTGCAGACAACGTACAGTCCATTAGCACTGAAAATACGACAGCAGATGGCGACAATGCAGGACAGTAGACCTCACCCTTTCCAGACTTTAGAGCTTGTGGCTTGAATGTTAAAGGTGTGACCACCGACA

Ensembl | human accession no.

ENSG00000153879

NCBI accession no.

NM_001806

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CEBPG(1054) , CEBPG(1054)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yanhui Yu et al.
DNA and cell biology, 36(3), 212-218 (2017-01-17)
Autophagy is a main defense strategy by which infected host cells can virtually induce the killing of parasite, including Toxoplasma gondii. However, the regulatory mechanisms of autophagy in T. gondii-infected nonhematopoietic cells are still unknown. Emerging evidence indicates that CCAAT/enhancer-binding
Hyun Lim et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 76, 153255-153255 (2020-06-20)
Prolonged exposure to the senescence-associated secretory phenotype (SASP) with age leads to chronic low-grade inflammation in neighboring cells and tissues, causing many chronic degenerative diseases. The effects on SASP production of the ethanol extract from Scutellaria radix and 17 isolated
Nirmalya Dasgupta et al.
Biochimica et biophysica acta, 1861(7), 1777-1787 (2017-03-28)
Human polo-like kinase 1 (PLK1), a highly conserved serine/threonine kinase is a key player in several essential cell-cycle events. PLK1 is considered an oncogene and its overexpression often correlates with poor prognosis of cancers, including colorectal cancer (CRC). However, regulation
Hye-Lim Lee et al.
International journal of molecular sciences, 19(10) (2018-10-17)
Distal-less homeobox 5 (Dlx5) is a negative regulator of adipogenesis. Dlx5 expression is decreased by adipogenic stimuli, but the mechanisms of Dlx5 downregulation by adipogenic stimuli have not yet been determined. Here, we tested the impact of cAMP/PKA (protein kinase
Hong Li et al.
Genetic testing and molecular biomarkers, 23(5), 304-309 (2019-04-11)
Aims: Metastasis is a significant obstacle to curing esophageal squamous cell carcinoma (ESCC). The CCAAT/enhancer binding protein β (C/EBPβ)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service