Skip to Content
Merck
All Photos(1)

Key Documents

More Documents

EHU008661

Sigma-Aldrich

MISSION® esiRNA

targeting human GADD45GIP1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTAAGCAGTTCGCGCGTTACGGCGCCGCCTCCGGGGTGGTCCCCGGTTCGTTATGGCCGTCGCCGGAGCAGCTGCGGGAGCTGGAGGCCGAAGAACGCGAATGGTACCCGAGCCTGGCGACCATGCAGGAGTCGCTGCGGGTGAAGCAGCTGGCCGAAGAGCAGAAGCGTCGGGAGAGGGAGCAGCACATCGCAGAGTGCATGGCCAAGATGCCACAGATGATTGTGAACTGGCAGCAGCAGCAGCGGGAGAACTGGGAGAAGGCCCAGGCTGACAAGGAGAGGAGGGCCCGACTGCAGGCTGAGGCCCAGGAGCTCCTGGGCTACCAGGTGGACCCAAGGAGTGCCCGCTTCCAGGAGCTGCTCCAGGACCTAGAGAAGAAGGAGCGCAAGCGCCTCAAGGAGGAAAAACAGAAACGGAAGAAGGAGGCGCGAGCTGCTGCATTGGCTGCAGCTGTGGCTCAAGACCCAGCAGCCTCTGGGGCACCCAGCTCCTGAGGCTTTGTCCCTTCCCAATAAAGCCTGCTACCTGGCA

Ensembl | human accession no.

ENSG00000179271

NCBI accession no.

NM_052850

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GADD45GIP1(90480) , GADD45GIP1(90480)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Harsha Nagar et al.
Antioxidants & redox signaling, 27(4), 234-249 (2017-01-25)
Mitochondrial dysfunction has emerged as a major contributing factor to endothelial dysfunction and vascular disease, but the key mechanisms underlying mitochondrial dysfunction-induced endothelial dysfunction remain to be elucidated. In this study, we aim at determining whether mitochondrial dysfunction in endothelial
Runzhou Zhuang et al.
Oncotarget, 8(55), 94759-94768 (2017-12-08)
CR6-interacting factor 1 (CRIF1) regulates cell cycle progression and the DNA damage response. Here, we show that CRIF1 expression is decreased in hepatocellular carcinoma (HCC) tissues and positively correlates with patients' survival.
Min Joung Lee et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 40(7), 1546-1561 (2020-01-29)
Cerebral endothelial cells (ECs) require junctional proteins to maintain blood-brain barrier (BBB) integrity, restricting toxic substances and controlling peripheral immune cells with a higher concentration of mitochondria than ECs of peripheral capillaries. The mechanism underlying BBB disruption by defective mitochondrial
Shahrooz Vahedi et al.
Oncology reports, 34(1), 43-50 (2015-05-23)
Overexpression and hyperactivation of lymphocyte-specific protein tyrosine kinase (Lck) have been associated with leukemia development. We previously showed that, other than its known function as a cytoplasmic signal transducer, Lck also acts as a nuclear transcription factor in mouse leukemic
Harsha Nagar et al.
PloS one, 9(6), e98670-e98670 (2014-06-07)
Mitochondrial dysfunction has been implicated in the pathophysiology of various cardiovascular diseases. CRIF1 is a protein present in the mitochondria associated with large mitoribosomal subunits, and CRIF1 knockdown induces mitochondrial dysfunction and promotes ROS production. p66shc is a redox enzyme

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service