Skip to Content
Merck
All Photos(1)

Key Documents

EMU071691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Clk1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTTGCAAGCTTTGTCTTCAGGGTTGGAAAGATGAGACATTCAAAGAGAACTTACTGTCCTGACTGGGATGAAAGAGACTGGGATTATGGAACATGGAGAAGCAGCAGCAGTCACAAAAGAAAGAAGAGATCACATAGCAGCGCCCGTGAGCAAAAGCGCTGCAGGTACGATCACTCCAAAACGACAGACAGCTATTATCTGGAAAGCAGATCCATAAATGAGAAAGCTTATCATAGTCGACGCTATGTTGATGAATACAGGAATGACTACATGGGCTACGAGCCAGGGCATCCCTATGGAGAACCTGGAAGCAGATACCAGATGCATAGTAGCAAGTCCTCTGGTAGGAGTGGAAGAAGCAGTTACAAAAGTAAACACAGGAGTCGCCACCACACATCGCAGCACCATTCACACGGGATGAAATTGTTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Apiruck Watthanasurorot et al.
PLoS genetics, 9(3), e1003361-e1003361 (2013-04-05)
Daily, circadian rhythms influence essentially all living organisms and affect many physiological processes from sleep and nutrition to immunity. This ability to respond to environmental daily rhythms has been conserved along evolution, and it is found among species from bacteria
Egle Jakubauskiene et al.
The Journal of biological chemistry, 290(29), 18079-18089 (2015-05-30)
The removal of introns from mRNA precursors (pre-mRNAs) is an essential step in eukaryotic gene expression. The splicing machinery heavily contributes to biological complexity and especially to the ability of cells to adapt to altered cellular conditions. Inhibitory PAS domain

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service