Skip to Content
Merck
All Photos(1)

Key Documents

EHU064011

Sigma-Aldrich

MISSION® esiRNA

targeting human PSAT1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTAAAGCTGGTGGGACCTAATGTCACCTTAATTCTGACTTGAACTGGAAGCATTTTAAGAAATCTTGTTGCTTTTCTAACAAATTCCCGCGTATTTTGCCTTTGCTGCTACTTTTTCTAGTTAGATTTCAAACTTGCCTGTGGACTTAATAATGCAAGTTGCGATTAATTATTTCTGGAGTCATGGGAACACACAGCACAGAGGGTAGGGGGGCCCTCTAGGTGCTGAATCTACACATCTGTGGGGTCTCCTGGGTTCAGCGGCTGTTGATTCAAGGTCAACATTGACCATTGGAGGAGTGGTTTAAGAGTGCCAGGCGAAGGGCAAACTGTAGATCGATCTTTATGCTGTTATTACAGGAGAAGTGACATACTTTATATATGTTTATATTAGCAAGGTCTGTTTTTAATACCA

Ensembl | human accession no.

ENSG00000135069

NCBI accession no.

NM_021154

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PSAT1(29968) , PSAT1(29968)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yiqun Zhang et al.
OncoTargets and therapy, 13, 5443-5453 (2020-07-02)
A growing number of studies have found that the serine-glycine biosynthesis pathway is highly activated for biosynthesis in cancer progression and metastasis. Phosphoserine aminotransferase 1 (PSAT1) catalyzes the second step of the serine-glycine biosynthesis pathway; the effects and mechanism of
Nadia Vié et al.
Molecular cancer, 7, 14-14 (2008-01-29)
Colorectal cancer (CRC) is one of the most common causes of cancer death throughout the world. In this work our aim was to study the role of the phosphoserine aminotransferase PSAT1 in colorectal cancer development. We first observed that PSAT1
Stephanie Metcalf et al.
Clinical & experimental metastasis, 37(1), 187-197 (2019-10-21)
Breast cancer is the second leading cause of cancer-related deaths among women and 90% of these mortalities can be attributed to progression to metastatic disease. In particular, triple negative breast cancer (TNBC) is extremely aggressive and frequently metastasizes to multiple
J Patrick Murphy et al.
Cell reports, 24(9), 2381-2391 (2018-08-30)
NAD+ is a key metabolic redox cofactor that is regenerated from nicotinamide through the NAD+ salvage pathway. Here, we find that inhibiting the NAD+ salvage pathway depletes serine biosynthesis from glucose by impeding the NAD+-dependent protein, 3-phosphoglycerate dehydrogenase (PHGDH). Importantly, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service