Skip to Content
Merck
All Photos(1)

Key Documents

EHU015821

Sigma-Aldrich

MISSION® esiRNA

targeting human CD2AP

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGGCTGGAAGGAGAACTAAATGGGAGAAGAGGAATGTTCCCTGACAATTTCGTTAAGGAAATTAAAAGAGAGACGGAATTCAAGGATGACAGTTTGCCCATCAAACGGGAAAGGCATGGGAATGTAGCAAGTCTTGTACAACGAATAAGCACCTATGGACTTCCAGCTGGAGGAATTCAGCCACATCCACAAACCAAAAACATTAAGAAGAAGACCAAGAAGCGTCAGTGTAAAGTTCTTTTTGAGTACATTCCACAAAATGAGGATGAACTGGAGCTGAAAGTGGGAGATATTATTGATATTAATGAAGAGGTAGAAGAAGGCTGGTGGAGTGGAACCCTGAATAACAAGTTGGGACTGTTTCCCTCAAATTTTGTGAAAGAATTAGAGGTAACAGATGATGGTGAAACTCATGAAGCCCAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hye-Young Park et al.
The international journal of biochemistry & cell biology, 79, 370-381 (2016-09-04)
Angiotensin II (Ang II) works as a paracrine or autocrine cytokine agent to regulate renal functions and promotes podocytes dysfunction directly or indirectly, causing proteinuria. The glomerular slit diaphragm (SD) serves as a size-selective barrier and is linked to the
Dao Wang et al.
OncoTargets and therapy, 13, 6681-6697 (2020-08-09)
Pediatric acute promyelocytic leukemia (APL) accounts for 10% of pediatric acute myelogenous leukemia (AML) case and is accompanied by a tendency to hemorrhage. miR-188-5p plays an important role in adult AML. Therefore, the purpose of this study was to explore

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service