Skip to Content
Merck
All Photos(1)

Key Documents

EMU170301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nol3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGGACCTGAGAGGAAACTTGAGTAGACAGAAGCCACACACATCATTGTAACTGCTGTTTAATTGTCTGGCTTTCCTCTGAACTGGGAGCTCAGTGAGGGGCGTGGGGTCTAACCAGTCACAGACATACACAAGGAGCTCTGCACATATCTACTAAGTAAATGAATACAAACTTCCCAGCTGTGTTTCCAAGCTTCACAGATGGAAACATTAACTGAAAAGCCAGGGTTAGGACAGTACTAGCTCACTCTCCCACCGCTGAATCTGAAGTGAAATGAAAGCCTTAACCAGCTCTGTACTAATCCTGGCCTGAACGTGGGATAACAAACCCTAGGGCCTGCCCTGTAGGTTTGATTGTGGTTGCTCCCGCCTGTCCTAACCACTGCCAGAGACCAGCTGTGAGGCTGTGGTTAAAGACAGGCACAACCAAGACTAACATGGGGACTGAGGGTGGGACCAGGTGCTGGACTCACAAGACACAAGACACAGTGTGTCTGTGTGAGTGATAAGAAAGGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and
Andrea Ullius et al.
Nucleic acids research, 42(11), 6901-6920 (2014-05-02)
The appropriate expression of the roughly 30,000 human genes requires multiple layers of control. The oncoprotein MYC, a transcriptional regulator, contributes to many of the identified control mechanisms, including the regulation of chromatin, RNA polymerases, and RNA processing. Moreover, MYC

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service