Skip to Content
Merck
All Photos(1)

Key Documents

EHU109681

Sigma-Aldrich

MISSION® esiRNA

targeting human DHX9

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGGGCAGAAGGATTTTTGCACGAGAACATGGATCAAATAAGAAATTGGCAGCACAGTCCTGTGCCCTGTCACTTGTCAGACAACTGTACCATCTTGGAGTGGTTGAAGCTTACTCCGGACTTACAAAGAAGAAGGAAGGAGAGACAGTGGAGCCTTACAAAGTAAACCTCTCTCAAGATTTAGAGCATCAGCTGCAAAACATCATTCAAGAGCTAAATCTTGAGATTTTGCCCCCGCCTGAAGATCCTTCTGTGCCAGTTGCACTCAACATTGGCAAATTGGCTCAGTTCGAACCATCTCAGCGACAAAACCAAGTGGGTGTGGTTCCTTGGTCACCTCCACAATCCAACTGGAATCCTTGGACTAGTAGCAACATTGATGAGGGGCCTCTGGCTTTTGCTACTCC

Ensembl | human accession no.

ENSG00000135829

NCBI accession no.

NM_001357

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DHX9(1660) , DHX9(1660)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenmin Fu et al.
Journal of virology, 93(4) (2018-12-14)
Epstein-Barr virus (EBV) SM protein is an RNA-binding protein that has multiple posttranscriptional gene regulatory functions essential for EBV lytic replication. In this study, we identified an interaction between SM and DHX9, a DExH-box helicase family member, by mass spectrometry
Pratirodh Koirala et al.
Nature communications, 8, 14422-14422 (2017-02-09)
Despite the overwhelming number of human long non-coding RNAs (lncRNAs) reported so far, little is known about their physiological functions for the majority of them. The present study uses a CRISPR/Cas9-based synergistic activation mediator (SAM) system to identify potential lncRNAs
Jie Zhang et al.
Molecular medicine reports, 20(2), 1429-1435 (2019-06-08)
Pathological scarring is a result of the hypertrophy of scar tissue during tissue repair following trauma. The aim of the present study was to assess the effect of ubiquitin‑specific protease 4 (USP4) silencing on pathological scarring, and to evaluate the
Grace S Tan et al.
ACS chemical biology, 7(2), 403-410 (2011-10-27)
Argonaute proteins are the core components of the microRNP/RISC. The biogenesis and function of microRNAs and endo- and exo- siRNAs are regulated by Ago2, an Argonaute protein with RNA binding and nuclease activities. Currently, there are no in vitro assays
Tuğçe Aktaş et al.
Nature, 544(7648), 115-119 (2017-03-30)
Transposable elements are viewed as 'selfish genetic elements', yet they contribute to gene regulation and genome evolution in diverse ways. More than half of the human genome consists of transposable elements. Alu elements belong to the short interspersed nuclear element

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service