Skip to Content
Merck
All Photos(1)

Key Documents

EHU071861

Sigma-Aldrich

MISSION® esiRNA

targeting human APLN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTTTTCAGGAGCTCTGGTGAAGTGGGTGGAGCATCAGCGTTTGCTCAGTTAAGGGAGAGGTAGAGAGGGGCCCGTGAAGTCCTTTGTCACTTCTCTTGCCTTAGTGTGCCTCCCAATACTCCCTTCTTCCTGCCCCCACACCCCATCCCCAGCTAGCCCAAGCTCCAGGTCAGGAGGGGAGGGTGCTGGGCCTGACATGGCTATATACCCTCCCAGGAGTAAAAGCCAAGCAAGAGGTTGTTTTTGCCAAGAATCACAGAATGTTAGAGCTGACAGGACCCTTGAAGGTCACTTAGCCTTCTTAGGCAAACGCCTGCAAAACAGAAGCCTGGAGAGGGGAGTGACCTGCTCAGAGTCATTGCAGAGCCGGGATGGGGACCAGGTCTCCCATCTCCTACTTTATGACGCC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yoko Yokoyama et al.
Arthritis & rheumatology (Hoboken, N.J.), 70(10), 1661-1672 (2018-04-21)
Apelin/APJ signaling has been determined to regulate cardiac and arterial fibrosis and to be involved in the pathogenesis of pulmonary arterial hypertension. Our objective was to elucidate the role of apelin in skin fibrosis in systemic sclerosis (SSc). Expression of
Aung Than et al.
The Journal of biological chemistry, 290(23), 14679-14691 (2015-05-02)
Brown adipose tissue expends energy in the form of heat via the mitochondrial uncoupling protein UCP1. Recent studies showed that brown adipose tissue is present in adult humans and may be exploited for its anti-obesity and anti-diabetes actions. Apelin is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service