Skip to Content
Merck
All Photos(1)

Key Documents

EHU030861

Sigma-Aldrich

MISSION® esiRNA

targeting human FLG

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACAATCCAGGATGAAGCCTATGACACCACTGATAGTCTATTAGAAGAAAACAAAATATATGAAAGATCAAGGTCATCTGATGGCAAATCATCATCTCAAGTGAACAGGTCAAGACATGAAAATACAAGCCAGGTACCATTGCAGGAGTCCAGGACAAGAAAGCGTAGGGGATCCAGAGTTAGCCAGGACAGGGACAGTGAGGGACACTCAGAAGACTCTGAGAGGCACTCTGGGTCGGCTTCCAGAAACCATCATGGATCTGCGTGGGAGCAGTCAAGAGATGGCTCCAGACACCCCAGGTCCCATGATGAAGACAGAGCCAGTCATGGGCACTCTGCAGACAGCTCCAGACAATCAGGCACTCGTCACGCAGAGACTTCCTCTCGTGGACAGACTGCATCATCCCATGAACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shuli Li et al.
PloS one, 5(11), e14033-e14033 (2010-12-03)
As a culmination of efforts over the last years, our knowledge of the embryonic origins of the mammalian frontal and parietal cranial bones is unambiguous. Progenitor cells that subsequently give rise to frontal bone are of neural crest origin, while
Susanne Grether-Beck et al.
The Journal of investigative dermatology, 132(6), 1561-1572 (2012-03-16)
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service