NCSTUD001
MISSION® Synthetic microRNA Inhibitor
ath-miR416, Negative Control 1, Sequence from Arabidopsis thaliana with no homology to human and mouse gene sequences
Synonyme(s) :
Synthetic Tough Decoy, sTuD
Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
About This Item
Code UNSPSC :
12352200
Nomenclature NACRES :
NA.51
Produits recommandés
Gamme de produits
MISSION®
Forme
solid
Séquence mature
GGUUCGUACGUACACUGUUCA
Numéro d'accès Sanger mature/mineur
Numéro d'accès Sanger microARN
Température de stockage
−20°C
Vous recherchez des produits similaires ? Visite Guide de comparaison des produits
Description générale
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.† This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Autres remarques
Based on miRBase V19
Informations légales
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Mention d'avertissement
Warning
Mentions de danger
Conseils de prudence
Classification des risques
STOT RE 2 Inhalation
Organes cibles
Respiratory Tract
Code de la classe de stockage
11 - Combustible Solids
Classe de danger pour l'eau (WGK)
WGK 3
Point d'éclair (°F)
Not applicable
Point d'éclair (°C)
Not applicable
Certificats d'analyse (COA)
Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Ilker Tinay et al.
The Prostate, 78(12), 927-937 (2018-05-12)
MicroRNAs (miRNAs) are small non-coding RNAs, which negatively regulate gene expression and impact prostate cancer (PCa) growth and progression. Circulating miRNAs are stable and detectable in cell-free body fluids, such as serum. Investigation of circulating miRNAs presents great potential in
Qing-Yan Lin et al.
Biotechnology letters, 42(1), 35-44 (2019-11-25)
The study is to research how miR-34-SIRT1 is regulated during hypoxia in lung cancer cells. Analysis of publicly available datasets from patients with NSCLC did not reveal significant genomic alterations in RBM38, SIRT1, HIF1A, MIR34A, MIR34B, and MIR34C, but expectedly
Yao Dai et al.
Redox biology, 16, 255-262 (2018-03-20)
Several miR/s that regulate gene/s relevant in atherogenesis are being described. We identified a miR (miR-98) that targets LOX-1, a receptor for ox-LDL, and speculated that it might be relevant in atherogenesis. MicroRNA-98 was predicted by bioinformatics tools. The effects
Let-7a-regulated translational readthrough of mammalian AGO1 generates a microRNA pathway inhibitor.
Anumeha Singh et al.
The EMBO journal, 38(16), e100727-e100727 (2019-07-23)
Translational readthrough generates proteins with extended C-termini, which often possess distinct properties. Here, we have used various reporter assays to demonstrate translational readthrough of AGO1 mRNA. Analysis of ribosome profiling data and mass spectrometry data provided additional evidence for translational
Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..
Contacter notre Service technique