Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU196671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hmga2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGCATTCGTATAAGAAAAGCATTGTGTGTGACTCTGTGTCCACTCAGATGCCACCCCCACCATGATCATAGAAAATCTGCTTAGGACACCAAAGATGAGAACTAGACACTACTCTCCTTTCTTTGTGTATAATCTTGTAGACACTTACTTGATTTTTTTTTCTTTTTTTACTTTTCAATTCTGAATGAGACAAAATGCTGGTGTATCTTTTCATACAGCTAGCAAACCAGAATAGGTTATGCTCGTTTTTTGCTTTGTTTTGTTTTTCAAAAAGGGAAGTAAACGAGAACCGTTGACTCCTCCATTTATGGACTCATACACAGCAGCAGGAGTGATAAGCCCACAAGCTCTCTTTCCCGCCTCGGGAAATCTACACAGCCAAAAGCCACTTAGCCATAAATGACACTTGTCAGCCTTGAAGCATCGGAGATAACTAGCTGAGTAAAATGATCCTGTTTTGGAATTTAATGAAAAGGTTAACAGTACCCAATGAACCCACCCAAGTGATGAC

Numéro d'accès Ensembl | souris

ENSMUSG00000056758

Numéro d'accès NCBI

NM_010441

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... HMGA2(15364) , Hmga2(15364)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhouying Wu et al.
British journal of haematology, 171(5), 818-829 (2015-09-26)
Acute lymphoblastic leukaemia (ALL) in infants is an intractable cancer in childhood. Although recent intensive chemotherapy progress has considerably improved ALL treatment outcome, disease cure is often accompanied by undesirable long-term side effects, and efficient, less toxic molecular targeting therapies
Silvia Parisi et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(3), 1046-1058 (2016-12-07)
Lin28 RNA-binding proteins play important roles in pluripotent stem cells, but the regulation of their expression and the mechanisms underlying their functions are still not definitively understood. Here we address the above-mentioned issues in the first steps of mouse embryonic
Chun-Yu Kao et al.
PeerJ, 4, e1683-e1683 (2016-02-20)
High Mobility Group AT-hook 2 (HMGA2) is a nonhistone chromatin-binding protein which acts as a transcriptional regulating factor involved in gene transcription. In particular, overexpression of HMGA2 has been demonstrated to associate with neoplastic transformation and tumor progression in Colorectal
Liuping Wei et al.
Cellular signalling, 26(7), 1476-1488 (2014-03-25)
We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of
You-You Xia et al.
Biochemical and biophysical research communications, 463(3), 357-363 (2015-05-31)
Epithelial-mesenchymal transition (EMT) is associated with invasion and metastasis of cancer cells. High-mobility group AT-hook 2 (HMGA2) has been found to play a critical role in EMT in a number of malignant tumors. However, whether HMGA2 regulates the EMT in
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique