Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU190491

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkaa1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTTAAAGAAAGAAAAGTTGCAAGAATTTAGTGACTGCATGTGTATTTACTACTTAGCTCCTACAACTACTGTTTGGCCATATTTGCTCTCTAGATCCACACATGTATAATATACAGATATGCACATATATTCGAGTATATGTTTGCTTTTATTCTGAACCACTGAGATGTTAAGGTATATATATATATATATATATACCAGCCCTGAATACTTCAGCACTTCCTAAAAATAATAATAATGTCCTTTAGAAACCTTCTGAAACCATTATAAAATCAATAATTTCCAGATAGTGCCTGGTTTTCCAGATTAGCTGTAACTGCCCAGAATTCCATTTAAGTTACAGCCTGATTTTATTTGCAGTTCTTTAATCAGGTTAATAACACTATTTTGAAAAGATGTAGAAGAAATCCTTTCTTCAAACTGGCCAAGTTTATTTCAGGTTTTAATTCAAAATAATGAGTGGCTAAAGAAGTGTGATTTTTCTTCAATCTCTGATTTATATGCCTCTCTCC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ichiro Kawashima et al.
Experimental hematology, 43(7), 524-533 (2015-04-08)
Adenosine monophosphate-activated protein kinase (AMPK) is a sensor for cellular energy status. When the cellular energy level is decreased, AMPK is activated and functions to suppress energy-consuming processes, including protein synthesis. Recently, AMPK has received attention as an attractive molecular
Dong Joo Shin et al.
Journal of cellular biochemistry, 115(10), 1702-1711 (2014-05-14)
Various health effects have been attributed to the ginsenoside metabolite 20-O-β-D-glucopyranosyl-20(S)-protopanaxadiol (GPD); however, its effect on ultraviolet (UV)-induced matrix metalloproteinase (MMP)-1 expression and the mechanism underlying this effect are unknown. We examined the inhibitory effect of GPD on UV-induced MMP-1
Yan Lu et al.
Journal of cardiovascular pharmacology, 64(5), 420-430 (2014-07-01)
: Endocannabinoids are bioactive amides, esters, and ethers of long-chain polyunsaturated fatty acids. Evidence suggests that activation of the endocannabinoid pathway offers cardioprotection against myocardial ischemia, arrhythmias, and endothelial dysfunction of coronary arteries. As cardiac hypertrophy is a convergence point
Julie Sesen et al.
PloS one, 10(4), e0123721-e0123721 (2015-04-14)
High-grade gliomas, glioblastomas (GB), are refractory to conventional treatment combining surgery, chemotherapy, mainly temozolomide, and radiotherapy. This highlights an urgent need to develop novel therapies and increase the efficacy of radio/chemotherapy for these very aggressive and malignant brain tumors. Recently
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique