Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU085211

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ahr

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGGATTTGCAAGAAGGAGAGTTCTTGTTACAGGCGCTGAATGGCTTTGTGCTGGTTGTCACAGCAGATGCCTTGGTCTTCTATGCTTCCTCCACTATCCAAGATTACCTGGGCTTTCAGCAGTCTGATGTCATCCATCAGAGCGTATATGAGCTCATCCATACAGAAGACCGGGCGGAATTCCAGCGCCAGCTTCACTGGGCTCTAAACCCAGACTCTGCACAAGGAGTGGACGAAGCCCATGGCCCTCCACAGGCAGCAGTCTATTATACCCCAGACCAGCTTCCTCCAGAGAACGCTTCTTTCATGGAGAGGTGCTTCAGGTGCCGGCTGAGGTGCCTGCTGGATAATTCATCTGGTTTTCTGGCAATGAATTTCCAAGGGAGGTTAAAGTATCTTCATGGACAGAACAAGAAAGGGAAGGACGGAGCGCTGCTTCCTCCACAACTGGCTTTGTTTGCAATAGCTACTCCACTTCAGCCACCCTCCATCCTGGAAATTCGAA

Numéro d'accès Ensembl | souris

ENSMUSG00000019256

Numéro d'accès NCBI

NM_013464

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... AHR(11622) , Ahr(11622)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mariko Takami et al.
Journal of immunology (Baltimore, Md. : 1950), 195(6), 2520-2523 (2015-08-16)
The immunoregulatory functions of vitamin D have been well documented in various immunological disorders, including multiple sclerosis, arthritis, and asthma. IL-10 is considered a chief effector molecule that promotes the vitamin D-induced immunosuppressive states of T cells and accessory cells.
Travis B Salisbury et al.
Biochemical pharmacology, 91(3), 390-399 (2014-06-28)
The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that upon activation by the toxicant 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD) stimulates gene expression and toxicity. AHR is also important for normal mouse physiology and may play a role in cancer progression

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique