Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU076311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rela

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCATGTCTCACTCCACAGCTGAGCCCATGCTGATGGAGTACCCTGAAGCTATAACTCGCCTGGTGACAGGGTCCCAGAGGCCCCCTGACCCAGCTCCCACACCCCTGGGGACCTCGGGGCTTCCCAATGGTCTCTCCGGAGATGAAGACTTCTCCTCCATTGCGGACATGGACTTCTCTGCTCTTTTGAGTCAGATCAGCTCCTAAGGTGCTGACAGCGACCCTGCTCAGAGCACCAGGTTTCAGGGCACTGAAGCCTTCCCGAAGTGCGTACACATTCTGGGGAGTGTGCTCCAGCTGCCCCCGACTTGTTTGGGTGATCTCTCTGGGGCGGCACGTTTTACTCTTTATCTCGCTTTCGGAGGTGCTTTCGCAGGAGCATTAACCTCCTGGAGACGGAGCTGGGAGGACTCGGTGCATCCCTGTGTTGATAGCTCCTGCTTCGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Martyn K White et al.
PloS one, 9(10), e110122-e110122 (2014-10-14)
The human neurotropic polyomavirus JC (JCV) causes the fatal CNS demyelinating disease progressive multifocal leukoencephalopathy (PML). JCV infection is very common and after primary infection, the virus is able to persist in an asymptomatic state. Rarely, and usually only under
Yun Qu et al.
Cell biochemistry and function, 33(5), 320-325 (2015-07-17)
Nuclear factor-kappaB (NF-κB) is an important transcriptional factor and regulates a variety of pathophysiologic process involved in cell survival and death. This study aimed to assess the effects of NF-κB p65 subunit knockdown in suppression of nude mouse lung tumour
W Zhang et al.
European review for medical and pharmacological sciences, 18(9), 1361-1367 (2014-05-29)
S100A4 is a member of the S100 family of calcium-binding proteins, which possesses a wide range of biological functions, such as regulation of angiogenesis, cell survival, motility, and invasion. Here, we demonstrate for the first time a major role of
Maroof Alam et al.
Oncotarget, 5(9), 2622-2634 (2014-04-29)
The capacity of breast cancer cells to form mammospheres in non-adherent serum-free culture is used as a functional characteristic of the self-renewing stem-like cell population. The present studies demonstrate that silencing expression of the MUC1-C oncoprotein inhibits growth of luminal
Yuan Zhang et al.
Journal of neuroinflammation, 12, 156-156 (2015-09-05)
Mounting evidence has indicated that high-mobility group box 1 (HMGB1) is involved in cell activation and migration. Our previous study demonstrated that methamphetamine mediates activation of astrocytes via sigma-1 receptor (σ-1R). However, the elements downstream of σ-1R in this process

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique