Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU071401

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mknk1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATAACTCCCTGTGGCTGGAAGACACCAGTCTTGGGATTCCTCTGAGACTCCAAGTTAAAGAACCTTGTGGAGATGGGCAGCAGTGAGCCCCTTCCCATCGTGGATTCTGACAAGAGGAGGAAGAAGAAGCGTAAGACCCGGGCCACCGACTCTCTGCCAGGAAAGTTTGAAGATGTGTACCAGCTGACCTCGGAATTGCTGGGAGAAGGAGCCTATGCCAAAGTCCAGGGTGCTGTGAACCTACAGAGTGGGAAGGAGTATGCTGTCAAAATCATCGAGAAGCAAGCCGGGCACAGTCGAAGTCGAGTGTTCCGTGAGGTGGAGACACTGTATCAGTGTCAAGGGAACAGGAACATTTTGGAGCTGATTGAATTCTTTGAAGATGACACACGGTTTTACTTGGTCTTTGAGAAATTGCAAGGAGGCT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sergio Rius-Pérez et al.
Scientific reports, 9(1), 3775-3775 (2019-03-09)
p38α MAPK negatively regulates the G1/S and G2/M cell cycle transitions. However, liver-specific p38α deficiency impairs cytokinesis and reduces hepatocyte proliferation during cirrhosis and aging in mice. In this work, we have studied how p38α down-regulation affects hepatocyte proliferation after
Michael C Brown et al.
Journal of virology, 88(22), 13149-13160 (2014-09-05)
Translation machinery is a major recipient of the principal mitogenic signaling networks involving Raf-ERK1/2 and phosphoinositol 3-kinase (PI3K)-mechanistic target of rapamycin (mTOR). Picornavirus internal ribosomal entry site (IRES)-mediated translation and cytopathogenic effects are susceptible to the status of such signaling

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique