Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU039811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Irak1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGATTGGAGAGGGTGGTTTTGGATGTGTGTACCGAGCAGTCATGAGAAATACTACATATGCTGTGAAGAGACTGAAGGAGGAAGCTGACCTAGAGTGGACTATGGTGAAACAGAGCTTCTTAACAGAGGTGGAACAGCTATCAAGGTTTCGTCACCCAAATATCGTAGACTTTGCTGGCTACTGTGCAGAGAGTGGCTTATACTGCCTTGTTTATGGCTTCTTGCCCAATGGCTCCTTGGAGGATCAGCTCCACCTTCAGACCCAGGCCTGCTCCCCACTTTCCTGGCCTCAACGACTGGACATTCTTCTGGGCACAGCCCGGGCTATTCAGTTTTTACATCAGGATAGCCCCAGCCTTATCCATGGAGACATCAAGAGTTCTAACGTGCTTCTGGATGAGAGACTGATGCCCAAGCTGGGAGACTTTGGCCTGGCTCGTTTCAGCCGCTTTGCGGGGGCCAAAGCAAGCCAGAGCAGTACTGTGGCCCGGACTTCCACAGTTCGAGGTACCC

Numéro d'accès Ensembl | souris

ENSMUSG00000031392

Numéro d'accès NCBI

NP_032389

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... IRAK1(16179) , Irak1(16179)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Florian Meisgen et al.
The Journal of investigative dermatology, 134(7), 1931-1940 (2014-03-29)
Keratinocytes represent the first line of defense against pathogens in the skin and have important roles in initiating and regulating inflammation during infection and autoimmunity. Here we investigated the role of miR-146a in the regulation of the innate immune response
Zhen Ning Wee et al.
Nature communications, 6, 8746-8746 (2015-10-28)
Metastatic tumour recurrence due to failed treatments remains a major challenge of breast cancer clinical management. Here we report that interleukin-1 receptor-associated kinase 1 (IRAK1) is overexpressed in a subset of breast cancers, in particular triple-negative breast cancer (TNBC), where

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique