Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU036901

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Scarb1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAAATTTGGCCTGTTTGTTGGGATGAACAACTCGAATTCTGGGGTCTTCACTGTCTTCACGGGCGTCCAGAATTTCAGCAGGATCCATCTGGTGGACAAATGGAACGGACTCAGCAAGATCGATTATTGGCATTCAGAGCAGTGTAACATGATCAATGGGACTTCCGGGCAGATGTGGGCACCCTTCATGACACCCGAATCCTCGCTGGAATTCTTCAGCCCGGAGGCATGCAGGTCCATGAAGCTGACCTACAACGAATCAAGGGTGTTTGAAGGCATTCCCACGTATCGCTTCACGGCCCCCGATACTCTGTTTGCCAACGGGTCCGTCTACCCACCCAACGAAGGCTTCTGCCCATGCCGAGAGTCTGGCATTCAGAATGTCAGCACCTGCAGGTTTGGTGCGCCTCTGTTTCTCTCCCACCCCCACTTTTACAACGCCGACCCTGTGTTGTCAGAAGCTGTTCTTGGTCTGAACCCTAACCCAAAGGAGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Laeticia Lichtenstein et al.
Cardiovascular research, 106(2), 314-323 (2015-03-15)
High-density lipoproteins (HDLs) protect against atherosclerosis mainly due to their function in hepatobiliary reverse cholesterol transport (RCT). This is a process whereby excess cholesterol from peripheral tissues is transported by HDL particles to the liver for further metabolism and biliary
Georgia Schäfer et al.
PloS one, 4(12), e8448-e8448 (2009-12-31)
The interaction between Mycobacterium tuberculosis (Mtb) and host cells is complex and far from being understood. The role of the different receptor(s) implicated in the recognition of Mtb in particular remains poorly defined, and those that have been found to
Pin Yue et al.
PloS one, 5(3), e9906-e9906 (2010-04-03)
CD36 facilitates oxidized low density lipoprotein uptake and is implicated in development of atherosclerotic lesions. CD36 also binds unmodified high and very low density lipoproteins (HDL, VLDL) but its role in the metabolism of these particles is unclear. Several polymorphisms
Xia Chu et al.
Molecular nutrition & food research, 59(8), 1491-1503 (2015-05-07)
Ursolic acid (UA) is a triterpenoid compound with multifold biological functions. Our previous studies have reported that UA protects against high-fat diet-induced obesity and improves insulin resistance (IR). However, the potential mechanisms are still undefined. Free fatty acid (FFA) metabolism
Xiaoxiao Yang et al.
The Journal of biological chemistry, 290(36), 21788-21799 (2015-07-19)
The glutathione (GSH)-dependent antioxidant system has been demonstrated to inhibit atherosclerosis. Macrophage CD36 uptakes oxidized low density lipoprotein (oxLDL) thereby facilitating foam cell formation and development of atherosclerosis. It remains unknown if GSH can influence macrophage CD36 expression and cellular

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique