Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU036041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ripk1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGATGCACGTGCTAAAGACCCAGATAGATGTCCCACTTTCATTGAAAGGAAGGATAATCGTGGAGGCCATAGAAGGCATGTGCTACTTACATGACAAAGGTGTGATACACAAGGACCTGAAGCCTGAGAATATCCTCGTTGATCGTGACTTTCACATTAAGATAGCCGATCTTGGTGTGGCTTCCTTTAAGACATGGAGCAAACTGACTAAGGAGAAAGACAACAAGCAGAAAGAAGTGAGCAGCACCACTAAGAAGAACAATGGTGGTACCCTTTACTACATGGCACCCGAACACCTGAATGACATCAATGCAAAGCCCACGGAGAAGTCGGACGTGTACAGCTTTGGCATTGTCCTTTGGGCAATATTTGCAAAAAAGGAGCCCTATGAGAATGTCATCTGTACTGAGCAGTTCGTGATCTGCATAAAATCTGGGAACAGGCCAAATGTAGAGGAAATCCTTGAGTACTGTCCAAGGGAGATCATCAGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
Yuichi Miki et al.
Lasers in medical science, 30(6), 1739-1745 (2015-06-26)
Photodynamic therapy (PDT) using photosensitizer induces several types of cell death, such as apoptosis, necrosis, and autophagy, depending on the PDT procedure, photosensitizer type, and cell type. We previously demonstrated that PDT using the photosensitizer talaporfin sodium (mono-L-aspartyl chlorine e6
W He et al.
Oncogene, 33(23), 3004-3013 (2013-07-09)
Killing cancer cells through the induction of apoptosis is one of the main mechanisms of chemotherapy. However, numerous cancer cells have primary or acquired apoptosis resistance, resulting in chemoresistance. In this study, using a novel chalcone derivative chalcone-24 (Chal-24), we
H Schoeneberger et al.
Oncogene, 34(31), 4032-4043 (2014-11-11)
Evasion of apoptosis in pediatric acute lymphoblastic leukemia (ALL) is linked to aberrant expression of inhibitor of apoptosis (IAP) proteins and dysregulated redox homeostasis, rendering leukemic cells vulnerable to redox-targeting therapies. Here we discover that inhibition of antioxidant defenses via
Pedram Kharaziha et al.
Oncotarget, 6(35), 37066-37082 (2015-09-30)
Autophagy is one of the main cytoprotective mechanisms that cancer cells deploy to withstand the cytotoxic stress and survive the lethal damage induced by anti-cancer drugs. However, under specific conditions, autophagy may, directly or indirectly, induce cell death. In our

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique