Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU021521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tiam1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGATGGCAAGAGGGAGAAGGAAGTGGTCTTACCCAGTGTCCACCAGCACAACCCCGACTGTGACATTTGGGTCCATGAATATTTCACTCCATCCTGGTTCTGTCTACCCAACAACCAGCCAGCCTTGACGGTTGTCCGGCCAGGGGACACTGCGAGGGACACCTTGGAGCTCATTTGCAAGACACATCAACTGGATCATTCCGCCCATTACCTGCGCCTGAAATTCCTAATGGAGAACAGAGTGCAGTTCTACATCCCGCAGCCCGAGGAGGACATTTACGAGCTGCTTTACAAAGAAATTGAAATCTGTCCAAAAGTCACCCAGAATATCCACATTGAGAAGTCAGACGCGGCCGCTGATAATTACGGGTTTTTGCTTTCTTCTGTGGATGAAGATGGCATTCGAAGGCTCTACGTGAACAGTGTCAAGGAAACCGGGTTAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Minjuan Wu et al.
Clinical science (London, England : 1979), 129(7), 575-588 (2015-05-23)
The homing ability and secretory function of mesenchymal stem cells (MSCs) are key factors that influence cell involvement in wound repair. These factors are controlled by multilayer regulatory circuitry, including adhesion molecules, core transcription factors (TFs) and certain other regulators.
Mina Ding et al.
OncoTargets and therapy, 11, 4367-4375 (2018-08-14)
T-cell lymphoma invasion and metastasis inducing factor 1 (Tiam1) is known to be involved in tumor progression. However, its molecular roles and mechanism in pancreatic ductal adenocarcinoma (PDAC) remain unclear. The purpose of this study is to determine Tiam1 expression
G Zhu et al.
Oncogene, 34(49), 5971-5982 (2015-03-10)
Epidermal growth factor receptor (EGFR) signaling regulates cell growth and survival, and its overactivation drives cancer development. One important branch of EGFR signaling is through activation of GTPase Rac1, which further promotes cell proliferation, survival and cancer metastasis. Here, we
Helen J Whalley et al.
Nature communications, 6, 7437-7437 (2015-06-17)
Centrosome separation is critical for bipolar spindle formation and the accurate segregation of chromosomes during mammalian cell mitosis. Kinesin-5 (Eg5) is a microtubule motor essential for centrosome separation, and Tiam1 and its substrate Rac antagonize Eg5-dependent centrosome separation in early

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique