Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU016791

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prmt1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGATGGGTTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTGCACGCTCGGGACAAGTGGCTGGCACCCGATGGCCTCATCTTCCCAGACCGGGCCACCTTGTATGTGACAGCCATTGAGGACCGACAATATAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTTGATATGTCCTGCATTAAAGACGTGGCCATCAAGGAGCCCCTGGTGGACGTGGTGGACCCAAAGCAGCTGGTCACCAATGCCTGCCTCATAAAGGAGGTGGACATTTACACAGTCAAGGTGGAGGACCTGACCTTCACCTCCCCCTTCTGCCTGCAAGTGAAGAGGAACGACTACGTGCACGCGCTGGTGGCTTACTTCAACATCGAGTTCACCCGATGCCACAAGAGGACCGGCTTCTCCACCAGTCCTGAG

Numéro d'accès Ensembl | souris

ENSMUSG00000052429

Numéro d'accès NCBI

NM_019830

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... PRMT1(15469) , Prmt1(15469)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sreedevi Avasarala et al.
The Journal of biological chemistry, 290(21), 13479-13489 (2015-04-08)
Protein arginine methyl transferase 1 (PRMT1) was shown to be up-regulated in cancers and important for cancer cell proliferation. However, the role of PRMT1 in lung cancer progression and metastasis remains incompletely understood. In the present study, we show that
Bingshou Li et al.
Biochemical and biophysical research communications, 464(4), 982-987 (2015-07-15)
Accumulating evidence indicates that microRNAs function as oncogenes or tumor suppressor genes in human cancer. MiR-503 is deregulated in various human cancers and has been associated with hepatocellular carcinoma (HCC) progression. However, the underlying mechanisms of miR-503 involvement in the
Dong-Il Kim et al.
Oxidative medicine and cellular longevity, 2015, 617919-617919 (2015-11-20)
Oxidative stress-induced retinal pigment epithelial (RPE) cell damage is involved in the progression of diabetic retinopathy. Arginine methylation catalyzed by protein arginine methyltransferases (PRMTs) has emerged as an important histone modification involved in diverse diseases. Sirtuin (SIRT1) is a protein

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique