Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU015391

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Map2k5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGATGTGATAGGCCAGGTTCTGCCTGAAGCGACGACGACAGCGTTTGAATATGAAGATGAAGATGGTGATAGGATTACAGTAAGAAGCGATGAAGAGATGAAGGCAATGCTGTCCTACTATTATTCCACAGTAATGGAACAGCAAGTAAATGGCCAGCTAATAGAGCCGCTGCAGATATTTCCAAGAGCCTGCAAGCCTCCCGGGGAACGGAACATACATGGCCTGAAGGTGAATACACGGGCTGGGCCATCTCAACACACCAGCCCTGTGGTCTCAGATTCGCTTCCAAGCAATAGCTTGAAGAAGTCCTCAGCTGAACTGAGAAAGATACTGGCCAACGGCCAGATGAATGAACAAGACATACGGTATCGAGACACCCTTGGTCATGGCAACGGAGGCACAGTCTACAAAGCACATCATGTCCCA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shigeru Amano et al.
PloS one, 10(4), e0125054-e0125054 (2015-04-18)
The MEK/ERK pathways are critical for controlling cell proliferation and differentiation. In this study, we show that the MEK5/ERK5 pathway participates in osteoclast differentiation. ERK5 was activated by M-CSF, which is one of the essential factors in osteoclast differentiation. Inhibition
Shoichi Kaneshiro et al.
Biochemical and biophysical research communications, 463(3), 241-247 (2015-05-23)
Extracellular signal-regulated kinase 5 (ERK5) is a member of the mitogen-activated protein kinase (MAPK) family and is activated by its upstream kinase, MAPK kinase 5 (MEK5), which is a member of the MEK family. Although the role of MEK5 has

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique