Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU015011

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akt1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AACGATGGCACCTTTATTGGCTACAAGGAACGGCCTCAGGATGTGGATCAGCGAGAGTCCCCACTCAACAACTTCTCAGTGGCACAATGCCAGCTGATGAAGACAGAGCGGCCAAGGCCCAACACCTTTATCATCCGCTGCCTGCAGTGGACCACAGTCATTGAGCGCACCTTCCATGTGGAAACGCCTGAGGAGCGGGAAGAATGGGCCACCGCCATTCAGACTGTGGCCGATGGACTCAAGAGGCAGGAAGAAGAGACGATGGACTTCCGATCAGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGTGTGACCATGAACGAGTTTGAGTACCTGAAACTACTGGGCAAGGGCACCTTTGGGAAAGTGATTCTGGTGAAAGAGAAGGCCACAGG

Numéro d'accès Ensembl | souris

ENSMUSG00000001729

Numéro d'accès NCBI

NP_033782

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... AKT1(11651) , Akt1(11651)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tsung-Chieh Lin et al.
The Journal of pathology, 237(1), 50-61 (2015-05-01)
Ghrelin is an appetite-regulating molecule that promotes growth hormone (GH) release and food intake through growth hormone secretagogue receptor (GHS-R). Recently, high ghrelin levels have been detected in various types of human cancer. Ghrelin expression is observed in proximal and
Lucía Barbier-Torres et al.
Oncotarget, 6(4), 2509-2523 (2015-02-05)
The current view of cancer progression highlights that cancer cells must undergo through a post-translational regulation and metabolic reprogramming to progress in an unfriendly environment. In here, the importance of neddylation modification in liver cancer was investigated. We found that
Heming Li et al.
Molecular cancer, 13, 136-136 (2014-06-03)
Insulin-like growth factor I (IGF-I) can induce epithelial mesenchymal transition (EMT) in many epithelial tumors; however, the molecular mechanism by which this occurs is not clearly understood. Additionally, little is known about the involvement of IGF-I in gastric cancer. Two
Xiaozhan Zhang et al.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 34, 415-422 (2015-06-13)
Viral infections activate many host signaling pathways, including the phosphatidylinositol 3-kinase (PI3K)/Akt pathway, which has recently attracted considerable interest due to its central role in modulating virus replication. This study demonstrated that the sero-type 3 reovirus strain Masked Palm Civet/China/2004
J R Tejedo et al.
Cell death & disease, 1, e80-e80 (2011-03-04)
Nitric oxide (NO) is an intracellular messenger in several cell systems, but its contribution to embryonic stem cell (ESC) biology has not been characterized. Exposure of ESCs to low concentrations (2-20 μM) of the NO donor diethylenetriamine NO adduct confers protection
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique