Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU003111

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ihh

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCTAACCACTGCCCTCCTGGAACTGCTGTGCTGGATCCAAAGGCCTCCTCACCAGGAAGGCTCTGGCCCTGGAAGGCACCTGGCCTGAGGTTGTCTCCGTCCTCTGTGCCAGAGTGGAGACACCATTGAGACTTGACCAGGTTTGCTGGGCCCCGAACCTTCATCTTGGTGTAGAGCTGTGAACTGAGCTGACAAGCGTGTGGTAGGCTCTCTTTTCCTAGAGACCGTAAGACCCAGCTAGCTCTGGCTGCGATTCTTCACACGCATTCCATCTGTCTTTGGACTGCTTACTCCAATGTTTCTCGGGGCCTGGGATTGTGACTTTACTGTTGGCAACTGATCACAGTATGAAGAGAGGCTGCCCGTAGATGGGCTTGCACCTCAGTCGATGCTGCTAGATTCCC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ang Deng et al.
Experimental and therapeutic medicine, 15(1), 789-794 (2018-02-13)
The proliferative rate of chondrocytes affects bone elongation. Chondrocyte hypertrophy is required for endochondral bone formation as chondrocytes secrete factors required for osteoblast differentiation and maturation. Previous studies have demonstrated that the Indian hedgehog (Ihh) signaling pathway is a key
Shaowei Wang et al.
European spine journal : official publication of the European Spine Society, the European Spinal Deformity Society, and the European Section of the Cervical Spine Research Society, 24(8), 1720-1728 (2015-05-11)
To determine the role of Indian hedgehog (Ihh) signaling in human cartilage endplate (CEP) degeneration. CEP-degenerated tissues from patients with Modic I or II changes (n = 9 and 45, respectively) and normal tissues from vertebral burst fracture patients (n

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique