Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU159061

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AACTGGGGCAACCTTTTCTTCGCCTCTGCCTTTGCCTTCCTGGGGCTCTTGGCGCTGACAGTCACCTTTTCCTGCAACCTGGCCACCATTAAGGCCCTGGTGTCCCGCTGCCGGGCCAAGGCCACGGCATCTCAGTCCAGTGCCCAGTGGGGCCGCATCACGACCGAGACGGCCATTCAGCTTATGGGGATCATGTGCGTGCTGTCGGTCTGCTGGTCTCCGCTCCTGATAATGATGTTGAAAATGATCTTCAATCAGACATCAGTTGAGCACTGCAAGACACACACGGAGAAGCAGAAA

Numéro d'accès Ensembl | humain

ENSG00000050628

Numéro d'accès NCBI

NM_198716

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PTGER3(5733) , PTGER3(5733)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Cristian Rodriguez-Aguayo et al.
EBioMedicine, 40, 290-304 (2019-01-19)
Inflammatory mediator prostaglandin E2-prostaglandin E2 receptor EP3 (PTGER3) signaling is critical for tumor-associated angiogenesis, tumor growth, and chemoresistance. However, the mechanism underlying these effects in ovarian cancer is not known. An association between higher tumoral expression of PTGER3 and shorter
Yao Ye et al.
Journal of cancer research and clinical oncology, 146(9), 2189-2203 (2020-06-04)
Cervical cancer metastasis results in poor prognosis and increased mortality, which is not separated from inflammatory reactions accumulated by prostaglandin E2 (PGE2). As a specific G-protein coupled PGE2 receptor, EP3 is demonstrated as a negative prognosticator of cervical malignancy. Now
Ju-Fang Liu et al.
Molecular cancer, 9, 43-43 (2010-02-25)
Cyclooxygenase (COX)-2, the inducible isoform of prostaglandin (PG) synthase, has been implicated in tumor metastasis. Interaction of COX-2 with its specific EP receptors on the surface of cancer cells has been reported to induce cancer invasion. However, the effects of
Chenggang Li et al.
Molecular cancer research : MCR, 15(10), 1318-1330 (2017-07-16)
Tuberous sclerosis complex (TSC) is a tumor-suppressor syndrome affecting multiple organs, including the brain, skin, kidneys, heart, and lungs. TSC is associated with mutations in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique