Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU158871

Sigma-Aldrich

MISSION® esiRNA

targeting human TRADD

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGGAGAACGAGCTCACCAGCCTGGCAGAGGACTTGCTGGGCCTGACCGATCCCAATGGCGGCCTGGCCTAGACCAGGGGTGCAGCCAGCTTTTGGAGAACCTGGATGGCCTTAGGGTTCCTTCTGCGGCTATTGCTGAACCCCTGTCCATCCACGGGACCCTGAAACTCCACTTGGCCTATCTGCTGGACCTGCTGGGGCAGAGTTGATTGCCTTCCCCAGGAGCCAGACCACTGGGGGTGCATCATTGGGGATTCTGCCTCAGGTACTTTGATAGAGTGTGGGGTGGGGGGGACCTGCTTTGGAGATCAGCCTCACCTTCTCCCATCCCAGAAGCGGGGCTTACAGCCAGCCCTTACAGTTTCACTCATGAAGCACCTTGATCTTTGGTGTCCTGGACTTCATCCTGGGTGCTGCAGATAC

Numéro d'accès Ensembl | humain

ENSG00000102871

Numéro d'accès NCBI

NM_003789

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TRADD(8717) , TRADD(8717)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tian-Ping Chen et al.
Molecular medicine (Cambridge, Mass.), 27(1), 21-21 (2021-03-05)
Studies have found that circular RNAs (circRNAs) play key roles in cardiovascular diseases. However, the function of circROBO2 in acute myocardial infarction (AMI) is unclear. This study aimed to investigate the pathogenesis of circROBO2 in AMI. qRT-PCR and Western blot
Hua Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(5), 1063-1078 (2016-12-14)
Chronic lung infection in cystic fibrosis leads to an inflammatory response that persists because of the chronic presence of bacteria and ultimately leads to a catastrophic failure of lung function. We use a combination of biochemistry, cell and molecular biology
Ganqian Zhu et al.
Journal of immunology (Baltimore, Md. : 1950), 198(3), 1104-1118 (2017-01-01)
The apoptosis of glomerular mesangial cells (GMCs) in the early phase of rat Thy-1 nephritis (Thy-1N), a model of human mesangioproliferative glomerulonephritis (MsPGN), is primarily triggered by sublytic C5b-9. However, the mechanism of GMC apoptosis induced by sublytic C5b-9 remains

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique