Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU158801

Sigma-Aldrich

MISSION® esiRNA

targeting human MYLK (1)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAGAATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTGCTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAGCCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTGTCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATCTGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAACGTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTATGGAACCAGTGAGCCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sho Hiroyasu et al.
Journal of cell science, 130(14), 2329-2343 (2017-06-10)
During healing of the skin, the cytoskeleton of keratinocytes and their matrix adhesions, including focal adhesions (FAs), undergo reorganization. These changes are coordinated by small GTPases and their regulators, including the guanine nucleotide exchange factor β-PIX (also known as ARHGEF7).
A Martinsen et al.
Pflugers Archiv : European journal of physiology, 466(7), 1377-1389 (2013-10-29)
The Ca(2+)-dependent kinase myosin light chain kinase (MLCK) is the activator of smooth muscle contraction. In addition, it has been reported to be involved in Ca(2+) channel regulation in cultured cells, and we previously showed that the MLCK inhibitor ML-7

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique