Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU158101

Sigma-Aldrich

MISSION® esiRNA

targeting human JAG2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCGGAGAAGTTCCTCTCACACAAATTCACCAAAGATCCTGGCCGCTCGCCGGGGAGGCCGGCCCACTGGGCCTCAGGCCCCAAAGTGGACAACCGCGCGGTCAGGAGCATCAATGAGGCCCGCTACGCCGGCAAGGAGTAGGGGCGGCTGCCAGCTGGGCCGGGACCCAGGGCCCTCGGTGGGAGCCATGCCGTCTGCCGGACCCGGAGGCCGAGGCCATGTGCATAGTTTCTTTATTTTGTGTAAAAAAACCACCAAAAACAAAAACCAAATGTTTATTTTCTACGTTTCTTTAACCTTGTATAAATTATTCAGTAACTGTCAGGCTGAAAACAATGGAGTATTCTCGGATAGTTGCTATTTTTGTAAAGTTTCCGTGCGTGGCACTCGCTGTATGAAAGGAGAGAGCAAAGGGTGTCTGCGTCGTCACCAAATCGTAGCGTTTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shouwen Chen et al.
Fish & shellfish immunology, 95, 277-286 (2019-11-02)
Interleukine-1β (IL-1β) is the first identified pro-inflammatory cytokine, which is cleaved by caspase-1 following the inflammasomes activation, playing critical roles in innate immunity. However, few studies have been performed to characterize the IL-1β in lower vertebrates. Herein, we distinguished the
Mo-fei Li et al.
Developmental and comparative immunology, 51(1), 141-147 (2015-03-25)
In mammals, CD83 is a surface marker on mature dendritic cells and vital to lymphocyte activation. In teleost, studies on the function of CD83 are very limited. In this study, we examined the potential involvement of turbot (Scophthalmus maximus) CD83
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and

Global Trade Item Number

RéférenceGTIN
EHU158101-20UG4061831367577
EHU158101-50UG4061831376579

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique