Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU157721

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB25

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAATGAGTTCAGCCACGACAGCCGCACCACCATCGGGGTTGAGTTCTCCACCCGCACTGTGATGTTGGGCACCGCTGCTGTCAAGGCTCAGATCTGGGACACAGCTGGCCTGGAGCGGTACCGAGCCATCACCTCGGCGTACTATCGTGGTGCAGTGGGGGCCCTCCTGGTGTTTGACCTAACCAAGCACCAGACCTATGCTGTGGTGGAGCGATGGCTGAAGGAGCTCTATGACCATGCTGAAGCCACGATCGTCGTCATGCTCGTGGGTAACAAAAGTGACCTCAGCCAGGCCCGGGAAGTGCCCACTGAGGAGGCCCGAATGTTCGCTGAAAACAATGGACTGCTCTTCCTGGAGACCTCAGCCCTGGACTCTACCAATGTTGAGCTAGCCTTTGAGACTGTCCTGAAAGAAATCTTTGCGAAGGTGTCCAAGCAGAGACAGAACAGCATCCGG

Numéro d'accès Ensembl | humain

ENSG00000132698

Numéro d'accès NCBI

NM_020387

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RAB25(57111) , RAB25(57111)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sehime Gulsun Temel et al.
Apoptosis : an international journal on programmed cell death, 25(11-12), 799-816 (2020-09-10)
Ovarian cancer remains one of the most frequent causes of cancer-related death in women. Many patients with ovarian cancer suffer from de novo or acquired resistance to chemotherapy. Here, we report that RAB25 suppresses chemotherapy-induced mitochondrial apoptosis signaling in ovarian
Moorthy Krishnan et al.
Molecular biology of the cell, 24(6), 818-831 (2013-01-25)
Rab25 is a tumor suppressor for colon cancer in humans and mice. To identify elements of intestinal polarity regulated by Rab25, we developed Caco2-BBE cell lines stably expressing short hairpin RNA for Rab25 and lines rescuing Rab25 knockdown with reexpression
Ukhyun Jo et al.
Oncotarget, 5(5), 1265-1278 (2014-03-25)
Oncogenic alterations of epidermal growth factor receptor (EGFR) signaling are frequently observed in lung cancer patients with worse differentiation and poor prognosis. However, the therapeutic efficacy of EGFR-tyrosine kinase inhibitors (TKIs) is currently limited in selected patients with EGFR mutations.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique