Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU152641

Sigma-Aldrich

MISSION® esiRNA

targeting human LAIR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTGGAGACAAGAGCTGGAGACTGGAGGTTTCTAACCAGCATCCAGAAGGTTCGTTAGCCAGGTGGTCCCTTCTACAATCGAGCAGCTCCTTGGACAGACTGTTTCTCAGTTATTTCCAGAGACCCAGCTACAGTTCCCTGGCTGTTTCTAGAGACCCAGCTTTATTCACCTGACTGTTTCCAGAGACCCAGCTAAAGTCACCTGCCTGTTCTAAAGGCCCAGCTACAGCCAATCAGCCGATTTCCTGAGCAGTGATGCCACCTCCAAGCTTGTCCTAGGTGTCTGCTGTGAACCTCCAGTGACCCCAGAGACTTTGCTGTAATTATCTGCCCTGCTGACCCTAAAGACCTTCCTAGAAGTCAAGAGCTAGCCTTGAGACTGTGCTATACACACACAGCTGAGAGCCAAGCCCAGTTCTCT

Numéro d'accès Ensembl | humain

ENSG00000167613

Numéro d'accès NCBI

NM_002287

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LAIR1(3903) , LAIR1(3903)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
NJU

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ying Zhang et al.
Microbial pathogenesis, 109, 292-299 (2017-06-20)
Helicobacter pylori is a Gram-negative, microaerophilic bacteria usually found in the stomach, which may evade its host's immune system and present long-term symptoms in affected individuals. This study aimed to evaluate the functional role of leukocyte-associated immunoglobulin (Ig)-like receptor-1 (LAIR-1)
Guofeng Fan et al.
Frontiers in bioscience (Landmark edition), 24, 1050-1059 (2019-03-08)
Vascular remodeling is a critical event following a stroke. It is a well known fact that  C1q is the first molecule in the complement classical pathway. However, its role in the neovascularization that ocurs after a stroke, remains unclear. In
Chitra Joseph et al.
Cancers, 13(1) (2021-01-06)
The leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) plays a role in immune response homeostasis, extracellular matrix remodelling and it is overexpressed in many high-grade cancers. This study aimed to elucidate the biological and prognostic role of LAIR-1 in invasive breast cancer (BC).

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique