Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU151451

Sigma-Aldrich

MISSION® esiRNA

targeting human BRD3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCGCTGCTGTGACAGAAAGTGAGTGAGCTGCCGGAGGATGTCCACCGCCACGACAGTCGCCCCCGCGGGGATCCCGGCGACCCCGGGCCCTGTGAACCCACCCCCCCCGGAGGTCTCCAACCCCAGCAAGCCCGGCCGCAAGACCAACCAGCTGCAGTACATGCAGAATGTGGTGGTGAAGACGCTCTGGAAACACCAGTTCGCCTGGCCCTTCTACCAGCCCGTGGACGCAATCAAATTGAACCTGCCGGATTATCATAAAATAATTAAAAACCCAATGGATATGGGGACTATTAAGAAGAGACTAGAAAATAATTATTATTGGAGTGCAAGCGAATGTATGCAGGACTTCAACACCATGTTTACAAATTGTTACATTTATAACAAGCCCACAGATGACATAGTGCTAATGGCCCAAGCTTTAGAGAAAATTTTTCTACAAAAAGTGGCCCAGATGCCCCAAGAGGAAGTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sarah R Wessel et al.
Cell reports, 28(13), 3497-3509 (2019-09-26)
Identifying proteins that function at replication forks is essential to understanding DNA replication, chromatin assembly, and replication-coupled DNA repair mechanisms. Combining quantitative mass spectrometry in multiple cell types with stringent statistical cutoffs, we generated a high-confidence catalog of 593 proteins
Niveditha Nerlakanti et al.
Molecular cancer therapeutics, 17(12), 2796-2810 (2018-09-23)
Resistance to androgen receptor (AR) antagonists is a significant problem in the treatment of castration-resistant prostate cancers (CRPC). Identification of the mechanisms by which CRPCs evade androgen deprivation therapies (ADT) is critical to develop novel therapeutics. We uncovered that CRPCs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique