Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU150301

Sigma-Aldrich

MISSION® esiRNA

targeting human SERPINA3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGGTAGTATGGGAGGTGGTGACTGCTCGGTACGTCTAATATGAACCAGGTGCCTTCATCATTTATCTCACCTGAGCCACTTAACAGGTTGTGCAGAGACGGAAACAGGTTGAGAGATGTACAGTCACCTGCTTGCCAGTACACAGCAATCAAAAGTGGCCAAAATAAAATCCCAGTCCAAGTCTGGGAGACTCCAAAGCCCTCTCTGCCTTCTCCCCACTAAGAGGCCCTTCCAGGCTTATGGTGGACACAGACACCACGTGGCAACCTGGCAGGGGCAGAGAAGAACATTTGCCTTTCTTTGGTCTTGCTGCCAACCATTATCAGGGCCATCGAGGCTCCAGACACTGTACCAGGGACTTTCATTTCCCTCTCTCAGTCGACCCTCACTGCCACCCAGCATCACATCGTGGAGGCCTGTGGAGGCCACACCACGTGACATCTAGAGGCTGGGAGAGTCACTGTGGCCTCTATCTCTGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Long-Lei Cao et al.
Digestive diseases and sciences, 63(9), 2309-2319 (2018-06-02)
To investigate the impact of SERPINA3 on the migration, invasion, and liver metastasis of colon cancer cells. Immunohistochemical staining was conducted to determine SERPINA3 expression in the cancer and adjacent normal tissues of 131 patients suffering from colon cancer. In

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique