Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU147391

Sigma-Aldrich

MISSION® esiRNA

targeting human LIMK2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCTAATCCATGGGGAGGTCCTGGGGAAGGGCTTCTTTGGGCAGGCTATCAAGGTGACACACAAAGCCACGGGCAAAGTGATGGTCATGAAAGAGTTAATTCGATGTGATGAGGAGACCCAGAAAACTTTTCTGACTGAGGTGAAAGTGATGCGCAGCCTGGACCACCCCAATGTGCTCAAGTTCATTGGTGTGCTGTACAAGGATAAGAAGCTGAACCTCCTGACAGAGTACATTGAGGGGGGCACACTGAAGGACTTTCTGCGCAGTATGGATCCGTTCCCCTGGCAGCAGAAGGTCAGGTTTGCCAAAGGAATCGCCTCCGGAATGGCCTATTTGCACTCTATGTGCATCATCCACCGGGATCTGAACTCGCACAACTGCCTCATCAAGTTGGACAAGACTGTGGTGGTG

Numéro d'accès Ensembl | humain

ENSG00000182541

Numéro d'accès NCBI

NM_001031801

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LIMK2(3985) , LIMK2(3985)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wei Wang et al.
International journal of cancer, 144(6), 1345-1355 (2018-07-15)
LIM kinases modulate multiple aspects of cancer development, including cell proliferation and survival. As the mechanisms of LIMK-associated tumorigenesis are still unclear, we analyzed the tumorigenic functions of LIM kinase 2 (LIMK2) in human bladder cancer (BC) and explored whether
Xing Duan et al.
Journal of cellular physiology, 233(8), 6088-6097 (2018-01-11)
LIM kinases (LIMK1/2) are LIM domain-containing serine/threonine/tyrosine kinases that mediate multiple cellular processes in mitosis. In the present study, we explored the functional roles and potential signaling pathway of LIMK1/2 during mouse oocyte meiosis. Disruption of LIMK1/2 activity and expression

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique