Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU142811

Sigma-Aldrich

MISSION® esiRNA

targeting human ROR2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTGAAGTGGAGGTTCTGGATCCGAACGACCCTTTAGGACCCCTTGATGGGCAGGACGGCCCGATTCCAACTCTGAAAGGTTACTTTCTGAATTTTCTGGAGCCAGTAAACAATATCACCATTGTCCAAGGCCAGACGGCAATTCTGCACTGCAAGGTGGCAGGAAACCCACCCCCTAACGTGCGGTGGCTAAAGAATGATGCCCCGGTGGTGCAGGAGCCGCGGCGGATCATCATCCGGAAGACAGAATATGGTTCACGACTGCGAATCCAGGACCTGGACACGACAGACACTGGCTACTACCAGTGCGTGGCCACCAACGGGATGAAGACCATTACCGCCACTGGCGTCCTGTTTGTGCGGCTGGGTCCAACGCACAGCCCAAATCATAACTTTCAGGATGATTACCACGAGGATGGGT

Numéro d'accès Ensembl | humain

ENSG00000169071

Numéro d'accès NCBI

NM_004560

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ROR2(4920) , ROR2(4920)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fernanda Faião-Flores et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5686-5701 (2019-06-23)
The clinical use of MEK inhibitors in uveal melanoma is limited by the rapid acquisition of resistance. This study has used multiomics approaches and drug screens to identify the pan-HDAC inhibitor panobinostat as an effective strategy to limit MEK inhibitor
Juho Heliste et al.
BMC cardiovascular disorders, 18(1), 196-196 (2018-10-22)
Receptor tyrosine kinases (RTK) are potential targets for the treatment of ischemic heart disease. The human RTK family consists of 55 members, most of which have not yet been characterized for expression or activity in the ischemic heart. RTK gene
Claire Henry et al.
Oncotarget, 6(37), 40310-40326 (2015-10-31)
In recent years, the Wnt signalling pathway has been implicated in epithelial ovarian cancer and its members have potential as diagnostic, prognostic and therapeutic targets. Here we investigated the role of two Wnt receptor tyrosine kinases (RTKs), ROR1 and ROR2
Atsuko Ishizuya-Oka et al.
PloS one, 9(9), e107611-e107611 (2014-09-12)
Amphibian intestinal remodeling, where thyroid hormone (T3) induces some larval epithelial cells to become adult stem cells analogous to the mammalian intestinal ones, serves as a unique model for studying how the adult stem cells are formed. To clarify its
Marie R Webster et al.
Pigment cell & melanoma research, 28(2), 184-195 (2014-11-20)
We have previously shown that Wnt5A drives invasion in melanoma. We have also shown that Wnt5A promotes resistance to therapy designed to target the BRAF(V600E) mutation in melanoma. Here, we show that melanomas characterized by high levels of Wnt5A respond

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique