Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU138681

Sigma-Aldrich

MISSION® esiRNA

targeting human MYOG

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTACAGATGCCCACAACCTGCACTCCCTCACCTCCATCGTGGACAGCATCACAGTGGAAGATGTGTCTGTGGCCTTCCCAGATGAAACCATGCCCAACTGAGATTGTCTTCCAAGCCGGGCATCCTTGCGAGCCCCCCAAGCTGGCCACAGATGCCACTACTTCTGTAGCAGGGGCCTCCTAAGCCAGGCTGCCCTGATGCTAGGAAGCCAGCTCTGGGGTGCCATAGGCCAGACTATCCCCTTCCTCATCCATGTAAGGTTAACCCACCCCCCAGCAAGGGACTGGACGCCCTCATTCAGCTGCCTCCTTAGAGGAGAGGGCATCCCCTTTCCAGGGAGGTAAAGCAGGGGACCAGAGCGCCCCCTCGTGTATGCCCCAGCTCAGGGGGCAAACTCAGGAGCTTCCTTTTTATCATAACGCGGCCTC

Numéro d'accès Ensembl | humain

ENSG00000122180

Numéro d'accès NCBI

NM_002479

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MYOG(4656) , MYOG(4656)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chi Yan et al.
International journal of molecular sciences, 16(10), 25014-25030 (2015-10-23)
Fat-induced transcript 1 (FIT1/FITM1) gene is a member of the conserved gene family important for triglyceride-rich lipid droplet accumulation. FIT1 gene displays a similar muscle-specific expression across pigs, mice, and humans. Thus pigs can act as a useful model of
Adeel Malik et al.
PloS one, 10(7), e0133597-e0133597 (2015-07-23)
Muscle, a multinucleate syncytium formed by the fusion of mononuclear myoblasts, arises from quiescent progenitors (satellite cells) via activation of muscle-specific transcription factors (MyoD, Myf5, myogenin: MYOG, and MRF4). Subsequent to a decline in Pax7, induction in the expression of
Sae-Won Lee et al.
Scientific reports, 5, 16523-16523 (2015-11-14)
Skeletal muscle regeneration occurs continuously to repair muscle damage incurred during normal activity and in chronic disease or injury. Herein, we report that A-kinase anchoring protein 6 (AKAP6) is important for skeletal myoblast differentiation and muscle regeneration. Compared with unstimulated
Majid Rasool Kamli et al.
Biochemical and biophysical research communications, 450(4), 1291-1296 (2014-07-06)
Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique