Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU138301

Sigma-Aldrich

MISSION® esiRNA

targeting human MGRN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCATCTACTGCCAGGCATCGGAGGAGTTCCTGAACGGCAGGGCAGTATACAGCCCCAAGAGCCCCTCGCTACAGTCCGAGACCGTCCACTACAAGAGAGGGGTGAGCCAGCAGTTCTCCCTGCCCTCCTTCAAGATTGACTTCTCGGAATGGAAGGATGACGAGCTGAACTTTGACCTGGACCGGGGCGTGTTTCCAGTAGTCATCCAGGCTGTGGTGGACGAAGGAGATGTGGTGGAAGTGACTGGCCACGCCCACGTGCTCTTGGCTGCCTTTGAAAAGCACATGGACGGCAGCTTCTCTGTGAAGCCTTTAAAGCAGAAGCAAATTGTGGACCGGGTCAGCTACCTCCTGCAGGAGATCTATGGCATTGAGAACAAGAACAACCAGGAGACCAAGCCCTCGGACGACGAGAACAGCGACAACAGCAA

Numéro d'accès Ensembl | humain

ENSG00000102858

Numéro d'accès NCBI

NM_001142289

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MGRN1(23295) , MGRN1(23295)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
XZU
OWU
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guan Sun et al.
Neuromolecular medicine, 21(1), 33-41 (2019-01-05)
Heat shock cognate protein 70 (Hsc70) is a key mediator for the maintenance of intracellular proteins and regulates cellular activities. And it is elevated in various tumor tissues including glioma, which is closely related to the malignancy and poor prognosis
Karen Legler et al.
British journal of cancer, 118(6), 847-856 (2018-01-31)
Alterations in protein glycosylation have been related to malignant transformation and tumour progression. We recently showed that low mRNA levels of Golgi alpha-mannosidase MAN1A1 correlate with poor prognosis in breast cancer patients. We analysed the role of MAN1A1 on a
Min Deng et al.
Molecular medicine reports, 20(1), 368-374 (2019-05-23)
The activation of hepatic stellate cells (HSCs) is considered associated with liver fibrosis. However, the exact role of syndecan‑1 (SDC1), a protein that regulates the interaction between cells and the microenvironment, in the activation of HSCs resulting in liver fibrosis
Hao Gao et al.
Cell cycle (Georgetown, Tex.), 18(12), 1393-1406 (2019-05-28)
Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy, and its vulnerability to metastasis contributes to the poor outcomes of EOC patients. Long noncoding RNAs (lncRNAs) were verified to play a pivotal role in EOC metastasis. However, the potential
Deepak Chhangani et al.
Biochimica et biophysica acta, 1842(9), 1472-1484 (2014-04-29)
Polyglutamine diseases are a family of inherited neurodegenerative diseases caused by the expansion of CAG repeats within the coding region of target genes. Still the mechanism(s) by which polyglutamine proteins are ubiquitinated and degraded remains obscure. Here, for the first
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique