Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU134591

Sigma-Aldrich

MISSION® esiRNA

targeting human PDE4B

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCAGGAAAGAGACCTCCTAAAGACATTCAGAATCTCATCTGACACATTTATAACCTACATGATGACTTTAGAAGACCATTACCATTCTGACGTGGCATATCACAACAGCCTGCACGCTGCTGATGTAGCCCAGTCGACCCATGTTCTCCTTTCTACACCAGCATTAGACGCTGTCTTCACAGATTTGGAGATCCTGGCTGCCATTTTTGCAGCTGCCATCCATGACGTTGATCATCCTGGAGTCTCCAATCAGTTTCTCATCAACACAAATTCAGAACTTGCTTTGATGTATAATGATGAATCTGTGTTGGAAAATCATCACCTTGCTGTGGGTTTCAAACTGCTGCAAGAAGAACACTGTGACATCTTCATGAATCTCACCAAGAAGCAGCGTCAGACAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xue-Qi Liu et al.
Biochemical pharmacology, 180, 114132-114132 (2020-07-06)
Acute kidney injury (AKI), characterized by a rapid decline in renal function, is triggered by an acute inflammatory response that leads to kidney damage. An effective treatment for AKI is lacking. Using in vitro and in vivo AKI models, our
Dan Li et al.
International immunopharmacology, 90, 107176-107176 (2020-11-28)
Roflupram (ROF) is a novel phosphodiesterase 4 inhibitor. We previously found that ROF suppressed the production of pro-inflammatory factors in microglial cells; however, the underlying mechanisms are largely unknown. The present study aimed to elucidate the underlying molecular mechanisms of
Jiahong Zhong et al.
Free radical biology & medicine, 135, 87-101 (2019-03-01)
The etiology of Parkinson's disease (PD) is generally not well understood, but it is believed to involve excessive oxidative insult. Hence, identifying therapeutic targets and compounds that exhibit protective effects against oxidative damage is a reasonable strategy to slow down
Hongyan Ma et al.
Biochemical and biophysical research communications, 450(4), 1560-1567 (2014-07-16)
Acute lung injury (ALI), acute respiratory distress syndrome (ARDS), is actually involved in an ongoing and uncontrolled inflammatory response in lung tissues. Although extensive studies suggested that phospodiesterase type 4B (PDE4B) may be related to inflammation, the underlying cell biological

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique