Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU130921

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFBI

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCA

Numéro d'accès Ensembl | humain

ENSG00000120708

Numéro d'accès NCBI

NM_000358

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TGFBI(7045) , TGFBI(7045)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Huan He et al.
Oncogene, 37(19), 2586-2600 (2018-02-23)
A critical mechanism that has been proposed for transcription regulation by estrogen receptor α (ER) is the tethering of ER to DNA via other transcription factors, such as AP-1. However, genome-wide assessment of the overlap in chromatin binding repertoires of
Tianhong Pan et al.
Neoplasia (New York, N.Y.), 20(1), 32-43 (2017-12-01)
Bone metastasis is common in renal cell carcinoma (RCC), and the lesions are mainly osteolytic. The mechanism of bone destruction in RCC bone metastasis is unknown. We used a direct intrafemur injection of mice with bone-derived 786-O RCC cells (Bo-786)
Bingyan Li et al.
BMC cancer, 12, 239-239 (2012-06-15)
Transforming growth factor β induced (TGFBI) product, an extracellular matrix (ECM) protein, has been implicated as a putative tumor suppressor in recent studies. Our previous findings revealed that expression of TGFBI gene is down-regulated in a variety of cancer cell

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique