Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU120781

Sigma-Aldrich

MISSION® esiRNA

targeting human CNR2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTGGGTGACAGAGATAGCCAATGGCTCCAAGGATGGCTTGGATTCCAACCCTATGAAGGATTACATGATCCTGAGTGGTCCCCAGAAGACAGCTGTTGCTGTGTTGTGCACTCTTCTGGGCCTGCTAAGTGCCCTGGAGAACGTGGCTGTGCTCTATCTGATCCTGTCCTCCCACCAACTCCGCCGGAAGCCCTCATACCTGTTCATTGGCAGCTTGGCTGGGGCTGACTTCCTGGCCAGTGTGGTCTTTGCATGCAGCTTTGTGAATTTCCATGTTTTCCATGGTGTGGATTCCAAGGCTGTCTTCCTGCTGAAGATTGGCAGCGTGACTATGACCTTCACAGCCTCTGTGGGTAGCCTCCTGCTGACCGCCATTGACCGATACCTCTGCCTGCGCTATCCACCTTCCTACAAAGCTCTGCTCACCCGTGGAAGGGCACTGGTGACCCTGGGCATCATGTGGGTCCTCTCAGC

Numéro d'accès Ensembl | humain

ENSG00000188822

Numéro d'accès NCBI

NM_001841

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CNR2(1269) , CNR2(1269)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Young Sun Hwang et al.
Chemico-biological interactions, 273, 107-114 (2017-06-12)
Melanogenesis plays a critical role in the protection of skin against external stresses such as ultraviolet irradiation and oxidative stressors. This study was aimed to investigate the effects of cannabidiol on melanogenesis and its mechanisms of action in human epidermal
Sabrina Fechtner et al.
Clinical and experimental rheumatology, 37(6), 1026-1035 (2019-04-04)
Recent studies showed that the expression of cannabinoid receptor 2 (CB2), not CB1, is upregulated at both the mRNA and protein levels in rheumatoid arthritis synovial fibroblasts (RASFs), however, little is known about its endogenous role in pro-inflammatory cytokine signalling
Sabrina Fechtner et al.
Frontiers in immunology, 10, 1027-1027 (2019-05-30)
Management of pain in the treatment of rheumatoid arthritis (RA) is a priority that is not fully addressed by the conventional therapies. In the present study, we evaluated the efficacy of cannabinoid receptor 2 (CB2) agonist JWH-015 using RA synovial
Lei Tian et al.
Frontiers in immunology, 8, 1214-1214 (2017-10-17)
Macrophage M1/M2 polarization mediates tissue damage and inflammatory responses. Cannabinoid receptor (CB) 1 participated in liver fibrogenesis by affecting bone marrow (BM)-derived monocytes/macrophages (BMMs) activation. However, the knowledge of whether CB1 is involved in the polarization of BMMs remains limited.
Ryosuke Kamikubo et al.
Molecular nutrition & food research, 60(10), 2228-2242 (2016-05-29)
Nonalcoholic fatty liver disease is currently the most common chronic liver disease worldwide, characterized by excessive hepatic lipid accumulation without significant ethanol consumption. We have performed a screening for medicinal foods that inhibit hepatocytic lipid accumulation through activation of AMP-activated

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique