Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU119251

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF15

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAACTTCTCGTCGCCAAAATGCCCAGTTGGGTATCTGGGTGATAGGCTGGTTGGCCGGCGGGCATATCACATGCTGCCCTCACCCGTCTCTGAAGATGACAGCGATGCCTCCAGCCCCTGCTCCTGTTCCAGTCCCGACTCTCAAGCCCTCTGCTCCTGCTATGGTGGAGGCCTGGGCACCGAGAGCCAGGACAGCATCTTGGACTTCCTATTGTCCCAGGCCACGCTGGGCAGTGGCGGGGGCAGCGGCAGTAGCATTGGGGCCAGCAGTGGCCCCGTGGCCTGGGGGCCCTGGCGAAGGGCAGCGGCCCCTGTGAAGGGGGAGCATTTCTGCTTGCCCGAGTTTCCTTTGGGTGATCCTGATGACGTCCCACGGCCCTTCCAGCCTACCCTGGAGGAGATTGAAGAGTTTCTGGAGGAGAACATGGAGCCTGGAGTCAAGGAGGTCCCTGAGGGCAACAGCAAGGACTTGGATGCCTGCAGCCAGCTCTCAGCTGGGCCACACAAGAGCCACCTCCATC

Numéro d'accès Ensembl | humain

ENSG00000163884

Numéro d'accès NCBI

NM_014079

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KLF15(28999) , KLF15(28999)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mi-Yeon Yu et al.
Experimental cell research, 386(1), 111706-111706 (2019-11-08)
Krüppel-like factor 15 (KLF15) is a well-known transcription factor associated with podocyte injury and fibrosis. Recently, hypertensive nephropathy was discovered to be closely related to podocyte injury and fibrosis. However, methods to stimulate hypertension in vitro are lacking. Here, we
Deepesh Pandey et al.
Arteriosclerosis, thrombosis, and vascular biology, 38(4), 913-926 (2018-02-24)
KLF15 (Kruppel-like factor 15) has recently been shown to suppress activation of proinflammatory processes that contribute to atherogenesis in vascular smooth muscle, however, the role of KLF15 in vascular endothelial function is unknown. Arginase mediates inflammatory vasculopathy and vascular injury
Seung Seok Han et al.
International journal of molecular medicine, 42(3), 1593-1602 (2018-06-15)
Krüppel‑like factor 15 (KLF15), also known as kidney‑enriched transcription factor, is known to participate in podocyte differentiation. However, the role of KLF15 in chronic podocyte injury remains incompletely understood, particularly in proteinuric disease models. In the present study, the 5/6 nephrectomy
Peter O Oladimeji et al.
Biochemical pharmacology, 160, 92-109 (2018-12-20)
The pregnane X receptor (PXR) is a principal xenobiotic receptor crucial in the detection, detoxification, and clearance of toxic substances from the body. PXR plays a vital role in the metabolism and disposition of drugs, and elevated PXR levels contribute to cancer

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique