Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU114901

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAACAACAGCAAGGAGGATGCCTTCTCCGGGACAGATTGGATGTTGGAGAAAATGGATTTGAAGGAGTTCGACTTGGATGCCCTGTTGGGTATAGATGACCTGGAAACCATGCCAGATGACCTTCTGACCACGTTGGATGACACTTGTGATCTCTTTGCCCCCCTAGTCCAGGAGACTAATAAGCAGCCCCCCCAGACGGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTTCACCTTCTTACAACCTCTTCCCCTTTCCCCAGGGGTCCTGTCCTCCACTCCAGATCATTCCTTTAGTTTAGAGCTGGGCAGTGAAGTGGATATCACTGAAGGAGATAGGAAGCCAGACTACACTGCTTACGTTGCCATGATCCCT

Numéro d'accès Ensembl | humain

ENSG00000128272

Numéro d'accès NCBI

NM_001675

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ATF4(468) , ATF4(468)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ritesh K Srivastava et al.
Toxicology and applied pharmacology, 308, 46-58 (2016-07-28)
Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here
Zhen Ren et al.
Toxicological sciences : an official journal of the Society of Toxicology, 154(2), 368-380 (2016-09-11)
Nefazodone, an antagonist for the 5-hydroxytryptanine receptor, has been used for the treatment of depression. Acute liver injury has been documented to be associated with the use of nefazodone; however, the mechanisms of nefazodone-induced liver toxicity are not well defined.
Wolfgang Fischer et al.
Redox biology, 21, 101089-101089 (2018-12-31)
Alzheimer's disease (AD) is the most frequent age-associated dementia with no treatments that can prevent or slow its progression. Since age is by far the major risk factor for AD, there is a strong rationale for an alternative approach to
Yoko Tabe et al.
Scientific reports, 8(1), 16837-16837 (2018-11-18)
Adipocytes are the prevalent stromal cell type in adult bone marrow (BM), and leukemia cells continuously adapt to deficiency of nutrients acquiring chemoresistant profiles in the BM microenvironment. We have previously shown that fatty acid metabolism is a key energy
Song Gao et al.
Journal of experimental & clinical cancer research : CR, 36(1), 179-179 (2017-12-09)
A growing amount of evidence has indicated that PSAT1 is an oncogene that plays an important role in cancer progression and metastasis. In this study, we explored the expression and function of PSAT1 in estrogen receptor (ER)-negative breast cancer. The
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique