Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU112501

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCCCTGGATGTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAAAGCCTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGGCTGTGCCTCCCCCGCCACCTGTGTGTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCAAAGCAACCA

Numéro d'accès Ensembl | humain

ENSG00000106211

Numéro d'accès NCBI

NM_001540

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... HSPB1(3315) , HSPB1(3315)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jong-Rung Tsai et al.
PloS one, 9(3), e91331-e91331 (2014-03-13)
Heat-shock proteins (HSPs) are molecular chaperones that protect proteins from damage. HSP27 expression is associated with cancer transformation and invasion. Ginkgo biloba extract (EGb761), the most widely sold herbal supplement, has antiangiogenic effects and induces tumor apoptosis. Data regarding the
Soo-Yeon Hwang et al.
European journal of medicinal chemistry, 139, 892-900 (2017-09-05)
Heat Shock Protein 27 (HSP27) is a member of small heat shock proteins with a highly-conserved α-crystalline domain. It inhibits aggregation of damaged proteins through a complex structural systems of phosphorylation-dependent oligomerization and self-assembly. It has been demonstrated that HSP27
Ah-Mee Park et al.
PloS one, 11(2), e0148998-e0148998 (2016-02-10)
Heat shock protein 27 (HSP27) is a member of the small molecular weight HSP family. Upon treatment with transforming growth factor β1 (TGF-β1), we observed upregulation of HSP27 along with that of α-smooth muscle actin (α-SMA), a marker of myofibroblast
Eva Hadadi et al.
Scientific reports, 6, 39035-39035 (2016-12-16)
Monocytes play a central role in regulating inflammation in response to infection or injury, and during auto-inflammatory diseases. Human blood contains classical, intermediate and non-classical monocyte subsets that each express characteristic patterns of cell surface CD16 and CD14; each subset
Su-Feng Chen et al.
PloS one, 7(11), e49275-e49275 (2012-11-16)
Treatment failure in oral squamous cell carcinoma (OSCC) leading to local recurrence(s) and metastases is mainly due to drug resistance. Cancer stem cells (CSCs) are thought be responsible for the development of drug resistance. However, the correlations between CSCs, drug
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique