Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU108431

Sigma-Aldrich

MISSION® esiRNA

targeting human GNAQ

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCACAATAAGGCTCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATATGTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCTTTAGAACAATTATCACATACCCCTGGTTCCA

Numéro d'accès Ensembl | humain

ENSG00000156052

Numéro d'accès NCBI

NM_002072

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GNAQ(2776) , GNAQ(2776)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Grazia Ambrosini et al.
Molecular cancer therapeutics, 13(8), 2073-2080 (2014-06-06)
The majority of uveal melanomas carry oncogenic mutations in the G proteins GNAQ and GNA11, with consequent activation of the MAPK pathway. Selective MEK inhibitors, such as selumetinib, have shown clinical benefit in uveal melanoma. However, mechanisms of drug resistance
Eva Königshausen et al.
Scientific reports, 6, 39513-39513 (2016-12-23)
Glomerular permeability and subsequent albuminuria are early clinical markers for glomerular injury in hypertensive nephropathy. Albuminuria predicts mortality and cardiovascular morbidity. AT1 receptor blockers protect from albuminuria, cardiovascular morbidity and mortality. A blood pressure independent, molecular mechanism for angiotensin II
Honglei Liu et al.
Oncology reports, 34(1), 295-301 (2015-05-09)
The occurrence of guanine nucleotide binding protein (G protein), q polypeptide (GNAQ) mutations has been found to be high in the majority of uveal melanomas. However, the underlying molecular mechanism of GNAQ mutations in modulating uveal melanoma is poorly understood.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique