Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU107771

Sigma-Aldrich

MISSION® esiRNA

targeting human IFITM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGGTCCCTGGCTAATTCACCAATTTACAAACAGCAGGAAATAGAAACTTAAGAGAAATACACACTTCTGAGAAACTGAAACGACAGGGGAAAGGAGGTCTCACTGAGCACCGTCCCAGCATCCGGACACCACAGCGGCCCTTCGCTCCACGCAGAAAACCACACTTCTCAAACCTTCACTCAACACTTCCTTCCCCAAAGCCAGAAGATGCACAAGGAGGAACATGAGGTGGCTGTGCTGGGGCCACCCCCCAGCACCATCCTTCCAAGGTCCACCGTGATCAACATCCACAGCGAGACCTCCGTGCCCGACCATGTCGTCTGGTCCCTGTTCAACACCCTCTTCTTGAACTGGTGCTGTCTGGGCTTCATAGCATTCGCCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACGTGACCGGGGCCCAGGCCTATGCCTCCACCGCCAAGTGCCTGAACATCTGGGCCCTGATTCTGGGCATCCTCAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hosni A M Hussein et al.
Scientific reports, 7(1), 17972-17972 (2017-12-23)
Kaposi's sarcoma-associated herpesvirus (KSHV) is etiologically associated with all forms of Kaposi's sarcoma worldwide. Little is currently known about the role of microRNAs (miRNAs) in KSHV entry. We recently demonstrated that KSHV induces a plethora of host cell miRNAs during
Hosni A M Hussein et al.
Scientific reports, 8(1), 14105-14105 (2018-09-22)
The oncogenic gammaherpesviruses, Epstein-Barr virus (EBV) and Kaposi's sarcoma herpesvirus (KSHV), are etiologically associated with a variety of human cancers, including Burkitt's lymphoma (BL), Hodgkin lymphoma (HL), Kaposi's sarcoma (KS), and primary effusion lymphoma (PEL). Recently, we demonstrated KSHV infection
Bo Feng et al.
Virology journal, 14(1), 213-213 (2017-11-05)
Endothelial cells are believed to play an important role in response to virus infection. Our previous microarray analysis showed that H9N2 virus infection and inactivated viral particle inoculation increased the expression of interferon-inducible transmembrane protein 1 (IFITM1) in human umbilical
Ying-Ying Xu et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(2), 576-592 (2018-07-22)
Although the interferon α (IFNα) signaling and the paired-like homeodomain transcription factor 2 (PITX2) have both been implicated in the progression of breast cancer (BCa), it remains obscure whether these two pathways act in a coordinated manner. We therefore aimed

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique